SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


peptidoglycan-editing factor, prevents incorporation of glycine or L-serine into the PG sacculi
30.79 kDa
protein length
278 aa Sequence Blast
gene length
837 bp Sequence Blast
quality control to maintain composition and integrity of peptidoglycan
peptidoglycan-editing factor

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of peptidoglycan]
  • Gene

    1,609,327 → 1,610,163

    Phenotypes of a mutant

  • sensitive to ß-lactam antibiotics [pubmed|28612943]
  • The protein

    Protein family

  • multicopper oxidase YfiH/RL5 family (single member, according to UniProt)
  • Structure

  • [PDB|1T8H] (from Geobacillus stearothermophilus, 52% identity)
  • Expression and Regulation



    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials


  • MGNA-B125 (ylmD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15370 (Δ[gene|ECCE99438DBFC52DA7236CB4F6486DD004CADF73|ylmD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATCCAACCTTTCG, downstream forward: _UP4_GGAATGAAGGAGGCATAAAA
  • BKK15370 (Δ[gene|ECCE99438DBFC52DA7236CB4F6486DD004CADF73|ylmD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATCCAACCTTTCG, downstream forward: _UP4_GGAATGAAGGAGGCATAAAA
  • References

  • 14651647,16420366,28612943