SubtiBank SubtiBank
ykwB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ykwB

unknown
locus
BSU_13940
pI
5.95
mw
19.53 kDa
protein length
226 aa Sequence Blast
gene length
681 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    1,462,813 → 1,463,493

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 18-219) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|ECB23B27C364EEB0BFB4C95BA62E9FF34AC852CF|ykwB]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-B332 (ykwB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1331 NBRP B. subtilis, Japan]
  • BKE13940 (Δ[gene|ECB23B27C364EEB0BFB4C95BA62E9FF34AC852CF|ykwB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTCTCCTTATGTTGT, downstream forward: _UP4_TGATCACAACAGCCCGTTTA
  • BKK13940 (Δ[gene|ECB23B27C364EEB0BFB4C95BA62E9FF34AC852CF|ykwB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTCTCCTTATGTTGT, downstream forward: _UP4_TGATCACAACAGCCCGTTTA