SubtiBank SubtiBank
ykwB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykwB

unknown
locus
BSU_13940
pI
5.95
mw
19.53 kDa
protein length
226 aa Sequence Blast
gene length
681 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    1,462,813 → 1,463,493

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 18-219) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|ECB23B27C364EEB0BFB4C95BA62E9FF34AC852CF|ykwB]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-B332 (ykwB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1331 NBRP B. subtilis, Japan]
  • BKE13940 (Δ[gene|ECB23B27C364EEB0BFB4C95BA62E9FF34AC852CF|ykwB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTCTCCTTATGTTGT, downstream forward: _UP4_TGATCACAACAGCCCGTTTA
  • BKK13940 (Δ[gene|ECB23B27C364EEB0BFB4C95BA62E9FF34AC852CF|ykwB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTCTCCTTATGTTGT, downstream forward: _UP4_TGATCACAACAGCCCGTTTA