SubtiBank SubtiBank
ykuP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ykuP

flavodoxin, binds FMN, replaces ferredoxin under conditions of iron limitation
locus
BSU_14170
pI
4.10
mw
20.11 kDa
protein length
151 aa Sequence Blast
gene length
456 bp Sequence Blast
function
electron transfer
product
flavodoxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • Gene

    Coordinates
    1,488,413 → 1,488,868

    The protein

    Protein family

  • flavodoxin family (with [protein|0932DDC285635C02067A3302CEDA302FE4269179|YkuN], according to UniProt)
  • Paralogous protein(s)

  • [protein|0932DDC285635C02067A3302CEDA302FE4269179|YkuN]
  • [SW|Domains]

  • [SW|Flavodoxin-like domain] (aa 4-144) (according to UniProt)
  • [SW|Cofactors]

  • FMN
  • Structure

  • [PDB|6FSG] (from B. cereus, 46% identity) [pubmed|29722453]
  • Expression and Regulation

    Operons

    genes
    [gene|0932DDC285635C02067A3302CEDA302FE4269179|ykuN]-[gene|CEC1B5DF1E548597FE333895ECA476AB9DFFFDD7|ykuO]-[gene|ECAFD2873ADE6B65C7B3C27FF26E0FAAA74839CC|ykuP]
    description
    [Pubmed|12354229]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12354229], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI]: sigma factor, [pubmed|29914988], in [regulon|3DEAC421B4B173C6BBC700E57790751B7AFDF319|SigI regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|24214949], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre]: repression, in [regulon|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|24214949], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|24214949]
  • induced by iron starvation (second wave) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [pubmed|29133393,12354229]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • additional information

  • the ''[protein|0932DDC285635C02067A3302CEDA302FE4269179|YkuN]-[protein|CEC1B5DF1E548597FE333895ECA476AB9DFFFDD7|YkuO]-[protein|ECAFD2873ADE6B65C7B3C27FF26E0FAAA74839CC|YkuP]'' operon is strongly unregulated in a ''[SW|kre]'' mutant [Pubmed|26110430]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B339 (ykuP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1338 NBRP B. subtilis, Japan]
  • BKE14170 (Δ[gene|ECAFD2873ADE6B65C7B3C27FF26E0FAAA74839CC|ykuP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCTTGTTCCTCCTCT, downstream forward: _UP4_TGATCACTCACTGGGAACTG
  • BKK14170 (Δ[gene|ECAFD2873ADE6B65C7B3C27FF26E0FAAA74839CC|ykuP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCTTGTTCCTCCTCT, downstream forward: _UP4_TGATCACTCACTGGGAACTG
  • References

  • 15449930,17127770,12354229,12107147,20186410,24214949,21665975,29133393,29914988,29722453