SubtiBank SubtiBank
grpE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

grpE

heat-shock protein (activation of [protein|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|DnaK])
locus
BSU_25480
pI
4.26
mw
21.54 kDa
protein length
187 aa Sequence Blast
gene length
564 bp Sequence Blast
function
control of [protein|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|DnaK] activity
product
heat-shock protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.2|Chaperones/ protein folding]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    Coordinates
    2,627,971 → 2,628,534

    The protein

    Protein family

  • grpE family (single member, according to UniProt)
  • Structure

  • [PDB|4ANI] ([protein|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|DnaK]-[protein|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|GrpE] complex from ''Geobacillus kaustophilus'', 70% identity) [Pubmed|22544739]
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]-[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]-[gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]-[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]-[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]-[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]-[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]
    description
    [Pubmed|9023197]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1339421], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA]: repression, [Pubmed|1339421], in [regulon|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA regulon]
  • regulation

  • induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
  • view in new tab

    Biological materials

    Mutant

  • BKE25480 (Δ[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTTCACCTCCCTCA, downstream forward: _UP4_TAATTACATAGCAGGAGGTT
  • BKK25480 (Δ[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTTCACCTCCCTCA, downstream forward: _UP4_TAATTACATAGCAGGAGGTT
  • labs

  • [SW|Wolfgang Schumann], Bayreuth University, Germany [http://www.genetik.uni-bayreuth.de/LSGenetik1/schumann_research.htm Homepage]
  • References

  • 10383760,9023197,1339421,16479537,1339421,7592421,22544739