SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


heat-shock protein (activation of [protein|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|DnaK])
21.54 kDa
protein length
187 aa Sequence Blast
gene length
564 bp Sequence Blast
control of [protein|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|DnaK] activity
heat-shock protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.2|Chaperones/ protein folding]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    2,627,971 → 2,628,534

    The protein

    Protein family

  • grpE family (single member, according to UniProt)
  • Structure

  • [PDB|4ANI] ([protein|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|DnaK]-[protein|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|GrpE] complex from ''Geobacillus kaustophilus'', 70% identity) [Pubmed|22544739]
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1339421], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA]: repression, [Pubmed|1339421], in [regulon|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA regulon]
  • regulation

  • induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
  • view in new tab

    Biological materials


  • BKE25480 (Δ[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTTCACCTCCCTCA, downstream forward: _UP4_TAATTACATAGCAGGAGGTT
  • BKK25480 (Δ[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTTCACCTCCCTCA, downstream forward: _UP4_TAATTACATAGCAGGAGGTT
  • labs

  • [SW|Wolfgang Schumann], Bayreuth University, Germany [ Homepage]
  • References

  • 10383760,9023197,1339421,16479537,1339421,7592421,22544739