SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


glycerol kinase
54.91 kDa
protein length
496 aa Sequence Blast
gene length
1488 bp Sequence Blast
glycerol utilization
glycerol kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of glycerol/ glycerol-3-phosphate]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    1,003,344 → 1,004,834

    The protein

    Catalyzed reaction/ biological activity

  • ATP + glycerol = ADP + sn-glycerol 3-phosphate (according to Swiss-Prot)
  • Protein family

  • FGGY kinase family (according to Swiss-Prot)
  • Modification

  • phosphorylation (His230) (according to Swiss-Prot)
  • Structure

  • [PDB|3H46] (from ''Enterococcus casseliflavus'', complex with glycerol) [Pubmed|19102629]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2127799], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]: antitermination, /antitermination via [protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]-dependent [SW|RNA switch], in [regulon|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: repression, [pubmed|28439033], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • induction by glycerol ([protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]) [Pubmed|8436953]
  • repressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [pubmed|28439033,10913079]
  • view in new tab

    Biological materials


  • BKE09290 (''glpK''::''ermC'') (available at the [ BGSC] and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP1865 (''glpK''::''ermC'') (available in [SW|Jörg Stülke]'s lab)
  • BKE09290 (Δ[gene|ECA8EBD553936CDD371B947D48B3C7D049B755BD|glpK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATAAGATGTCTCCCCT, downstream forward: _UP4_TAAAGTAATACTATGGTATA
  • BKK09290 (Δ[gene|ECA8EBD553936CDD371B947D48B3C7D049B755BD|glpK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATAAGATGTCTCCCCT, downstream forward: _UP4_TAAAGTAATACTATGGTATA
  • labs

  • [SW|Josef Deutscher], Paris-Grignon, France
  • References

  • 1335945,9162046,11929549,7773413,19102629,20817675,28439033,10913079,28458661