SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


glycerol kinase
54.91 kDa
protein length
496 aa Sequence Blast
gene length
1488 bp Sequence Blast
glycerol utilization
glycerol kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of glycerol/ glycerol-3-phosphate]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    1,003,344 → 1,004,834

    The protein

    Catalyzed reaction/ biological activity

  • ATP + glycerol = ADP + sn-glycerol 3-phosphate (according to Swiss-Prot)
  • Protein family

  • FGGY kinase family (according to Swiss-Prot)
  • Modification

  • phosphorylation (His230) (according to Swiss-Prot)
  • Structure

  • [PDB|3H46] (from ''Enterococcus casseliflavus'', complex with glycerol) [Pubmed|19102629]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2127799], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]: antitermination, /antitermination via [protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]-dependent [SW|RNA switch], in [regulon|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: repression, [pubmed|28439033], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • induction by glycerol ([protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]) [Pubmed|8436953]
  • repressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [pubmed|28439033,10913079]
  • view in new tab

    Biological materials


  • BKE09290 (''glpK''::''ermC'') (available at the [ BGSC] and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP1865 (''glpK''::''ermC'') (available in [SW|Jörg Stülke]'s lab)
  • BKE09290 (Δ[gene|ECA8EBD553936CDD371B947D48B3C7D049B755BD|glpK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATAAGATGTCTCCCCT, downstream forward: _UP4_TAAAGTAATACTATGGTATA
  • BKK09290 (Δ[gene|ECA8EBD553936CDD371B947D48B3C7D049B755BD|glpK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATAAGATGTCTCCCCT, downstream forward: _UP4_TAAAGTAATACTATGGTATA
  • Labs working on this gene/protein

  • [SW|Josef Deutscher], Paris-Grignon, France
  • References

  • 1335945,9162046,11929549,7773413,19102629,20817675,28439033,10913079,28458661