SubtiBank SubtiBank
fhuG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fhuG

hydroxamate siderophore [SW|ABC transporter ](ferrichrome und ferrioxamine) (permease)
locus
BSU_33300
pI
10.20
mw
36.00 kDa
protein length
336 aa Sequence Blast
gene length
1011 bp Sequence Blast
function
siderophore uptake
product
hydroxamate siderophore [SW|ABC transporter ](ferrichrome und ferrioxamine) (permease)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.5|Uptake of iron/ siderophores]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.1|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.4|ABC transporters for the uptake of iron/ siderophores]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,416,212 → 3,417,222

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|FecCD subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F38F6D4841B3044EA0496B3A1C1D484018BDFEA4|FeuC], [protein|34A7E22B4EF118EF5A76F8CC2DABBB023BC9A2E9|YfhA], [protein|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|FecE]
  • Structure

  • [PDB|4R9U], the ''E. coli'' BtuC-BtuD complex, BtuC shares 33% identity, 67% similarity with FhuG, [Pubmed|25402482]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3E1C925C31C00803982C8EB1C6B025C22DB4A828|fhuB]-[gene|EC98685EE0E3CE6CE8DC33409481AE96315279AC|fhuG]-[gene|E70BE74D5AB4B06CDFF902E58A0B9EBF477E21EC|fhuC]

    description

  • [pubmed|22383849]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [pubmed|29133393,12354229]
  • view in new tab

    Biological materials

    Mutant

  • BKE33300 (Δ[gene|EC98685EE0E3CE6CE8DC33409481AE96315279AC|fhuG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGTTTGTTTGTTTTTGTTT, downstream forward: _UP4_GCGAATTAGAGGAGGGGGCC
  • BKK33300 (Δ[gene|EC98685EE0E3CE6CE8DC33409481AE96315279AC|fhuG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGTTTGTTTGTTTTTGTTT, downstream forward: _UP4_GCGAATTAGAGGAGGGGGCC
  • References

  • 10092453,16672620,25402482,12354229,29133393