SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


formamidopyrimidine-DNA glycosidase
31.06 kDa
protein length
276 aa Sequence Blast
gene length
831 bp Sequence Blast
DNA repair
formamidopyrimidine-DNA glycosidase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Oxidized guanine (GO) DNA repair system]
  • Gene

    2,972,329 → 2,973,159

    Phenotypes of a mutant

  • increased susceptibility to Cr(VI) due to the accumulation of oxidative DNA damage [Pubmed|24973075]
  • absence of MutM promotes mutagenesis allowing nutritionally stressed ''B. subtilis'' cells to escape from growth limiting conditions [Pubmed|25825434]
  • increased sponteous mutation rate [Pubmed|25825434]
  • The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of DNA containing ring-opened 7-methylguanine residues, releasing 2,6-diamino-4-hydroxy-5-(N-methyl)formamidopyrimidine (according to UniProt)
  • The C-O-P bond 3' to the apurinic or apyrimidinic site in DNA is broken by a beta-elimination reaction, leaving a 3'-terminal unsaturated sugar and a product with a terminal 5'-phosphate (according to UniProt)
  • Protein family

  • FPG family (single member, according to UniProt)
  • Structure

  • [PDB|2F5S] (complex with oxoG:C, Geobacillus stearothermophilus)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|23396918], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    Biological materials


  • MGNA-A116 (mutM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29080 (Δ[gene|EC96EDED2472607DFA4C5EBA054157F7832EE41C|mutM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATCCATCACTTCCTATC, downstream forward: _UP4_TAGCATAATGCTTCATTGTC
  • BKK29080 (Δ[gene|EC96EDED2472607DFA4C5EBA054157F7832EE41C|mutM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATCCATCACTTCCTATC, downstream forward: _UP4_TAGCATAATGCTTCATTGTC
  • References


  • 22933559
  • Original publications

  • 19011023,19889642,24973075,25825434