SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


nitric oxide-responsive regulator
16.47 kDa
protein length
146 aa Sequence Blast
gene length
441 bp Sequence Blast
repression of [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]-[protein|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|ResE]-dependent genes in the absence of nitric oxide (NO)
transcriptional repressor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    1,013,411 → 1,013,851

    The protein


  • [SW|HTH rrf2-type domain] (aa 2-133) (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster, required for DNA-binding [Pubmed|21091510]
  • Effectors of protein activity

  • nitric oxide (NO) acts as molecular inducer and results in NsrR release from its DNA targets [Pubmed|19006327]
  • [4Fe-4S]-NsrR binds around the -35 element of the ''[gene|FAAC0F819AEC8E055CCEE86D93C8DE5584DC4B23|nasD]'' promoter with much higher affinity than apo-NsrR and binding of [4Fe-4S]-NsrR, but not apo-protein, is sensitive to NO [Pubmed|21091510]
  • Structure

  • [PDB|3LWF] (from Listeria innocua, 29% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A692 (yhdE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09380 (Δ[gene|EC6697D5D945B7E5083AFED9218748763C443278|nsrR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAAGACCTCAGAATA, downstream forward: _UP4_TAGATTAAGATTCCTTCTTT
  • BKK09380 (Δ[gene|EC6697D5D945B7E5083AFED9218748763C443278|nsrR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAAGACCTCAGAATA, downstream forward: _UP4_TAGATTAAGATTCCTTCTTT
  • References


  • 23046954,16261196,20167493
  • The [SW|NsrR regulon]

  • 22287527
  • Other original publications

  • 16885456,24214949,17293416,21091510,19006327,18989365,28439033