SubtiBank SubtiBank
ycbP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycbP

general stress protein
locus
BSU_02590
pI
6.31
mw
13.91 kDa
protein length
128 aa Sequence Blast
gene length
387 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    281,769 → 282,155

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EC3362AC3EE2595938A429D2839C5E362F514233|ycbP]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C037 (ycbP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2035 NBRP B. subtilis, Japan]
  • BKE02590 (Δ[gene|EC3362AC3EE2595938A429D2839C5E362F514233|ycbP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACAATTCCTCCTTTTG, downstream forward: _UP4_TAATGGAAAGGCCGGTGCTG
  • BKK02590 (Δ[gene|EC3362AC3EE2595938A429D2839C5E362F514233|ycbP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACAATTCCTCCTTTTG, downstream forward: _UP4_TAATGGAAAGGCCGGTGCTG
  • References

  • 15805528