SubtiBank SubtiBank
tcyP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tcyP

cystine and diaminopimelate transporter
locus
BSU09130
pI
9.47
mw
48.82 kDa
protein length
463 aa Sequence Blast
gene length
1392 bp Sequence Blast
function
cystine and diaminopimelate uptake
product
cystine and diaminopimelate transporter
essential
no
synonyms
yhcL

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.9|Biosynthesis/ acquisition of cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    986,986 → 988,377

    The protein

    Catalyzed reaction/ biological activity

  • cystine-proton symporter [Pubmed|15262924]
  • transport of diaminopimelate [pubmed|29995990]
  • Protein family

  • [SW|dicarboxylate/amino acid:cation symporter (DAACS) (TC 2.A.23) family] (according to UniProt)
  • Kinetic information

  • K(m) = 0.6 myM cystine [Pubmed|15262924]
  • Structure

  • [PDB|3KBC] (from ''Pyrococcus horikoshii'', 28% identity) [Pubmed|19924125]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|EC287BBD7AB1EB44A33BF29144448F53D06AC6D9|tcyP]

    regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of sulfate or cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A657 (yhcL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/657 NBRP B. subtilis, Japan]
  • 1A949 ( ''tcyP''::''spec''), [Pubmed|15262924], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A949&Search=1A949 BGSC]
  • BKE09130 (Δ[gene|EC287BBD7AB1EB44A33BF29144448F53D06AC6D9|tcyP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAGGTAAACTCTCCC, downstream forward: _UP4_TAACATATGAAAACGTGTAA
  • BKK09130 (Δ[gene|EC287BBD7AB1EB44A33BF29144448F53D06AC6D9|tcyP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAGGTAAACTCTCCC, downstream forward: _UP4_TAACATATGAAAACGTGTAA
  • labs

  • [[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
  • References

  • 15262924,12193636,16513748,16513748,18763711,19924125,29995990