SubtiBank SubtiBank
ywrE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywrE

unknown
locus
BSU_36090
pI
8.75
mw
13.41 kDa
protein length
111 aa Sequence Blast
gene length
336 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,718,794 → 3,719,129

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EC098261CA462610C864958EFEEFA830D6CDA96F|ywrE]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced by vancomycin ([protein|search|SigW]) [Pubmed|12207695]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A581 (ywrE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/581 NBRP B. subtilis, Japan]
  • BKE36090 (Δ[gene|EC098261CA462610C864958EFEEFA830D6CDA96F|ywrE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAATTCCTCCTAATC, downstream forward: _UP4_ATTTATGTTTGTACCCTATA
  • BKK36090 (Δ[gene|EC098261CA462610C864958EFEEFA830D6CDA96F|ywrE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAATTCCTCCTAATC, downstream forward: _UP4_ATTTATGTTTGTACCCTATA
  • References

  • 9987136,12207695