SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


glycogen synthase (ADPGlc)
55.69 kDa
protein length
484 aa Sequence Blast
gene length
1455 bp Sequence Blast
glycogen biosynthesis
glycogen synthase (ADPGlc)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of glycogen]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    3,166,118 → 3,167,572

    The protein

    Catalyzed reaction/ biological activity

  • [(1→4)-α-D-glucosyl](n) + ADP-α-D-glucose --> [(1→4)-α-D-glucosyl](n+1) + ADP + H+ (according to UniProt)
  • Protein family

  • glycosyltransferase 1 family (single member, according to UniProt)
  • Structure

  • [PDB|2QZS] (from E. coli, 37% identity) [pubmed|19244233]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8145641], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|8145641]
  • view in new tab

    Biological materials


  • BKE30950 (Δ[gene|EBEA85AD543B79C321CB5F28D1B7E1248640DC1D|glgA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCTGACACAGCAAATAATA, downstream forward: _UP4_GAGCAGGTGACAAGGAGTGG
  • BKK30950 (Δ[gene|EBEA85AD543B79C321CB5F28D1B7E1248640DC1D|glgA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCTGACACAGCAAATAATA, downstream forward: _UP4_GAGCAGGTGACAAGGAGTGG
  • References

  • 8145641,19244233