SubtiBank SubtiBank
glgA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

glgA

glycogen synthase (ADPGlc)
locus
BSU_30950
pI
5.16
mw
55.69 kDa
protein length
484 aa Sequence Blast
gene length
1455 bp Sequence Blast
function
glycogen biosynthesis
product
glycogen synthase (ADPGlc)
essential
no
ec
2.4.1.21
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.5|Biosynthesis of glycogen]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,166,118 → 3,167,572

    The protein

    Catalyzed reaction/ biological activity

  • [(1→4)-α-D-glucosyl](n) + ADP-α-D-glucose --> [(1→4)-α-D-glucosyl](n+1) + ADP + H+ (according to UniProt)
  • Protein family

  • glycosyltransferase 1 family (single member, according to UniProt)
  • Structure

  • [PDB|2QZS] (from E. coli, 37% identity) [pubmed|19244233]
  • Expression and Regulation

    Operons

    genes
    [gene|52C8DE3C78B680C8883D1CD559CBC2D9ABFCC400|glgB]-[gene|B665735B76462724A3C7A1E89D3E613C18F21399|glgC]-[gene|63A4FD35A2E72C665BFA3F2632F06C7A0C954087|glgD]-[gene|EBEA85AD543B79C321CB5F28D1B7E1248640DC1D|glgA]-[gene|3AB4513126EFF54996A54CB7DEB6062C1A06AAC3|glgP]
    description
    [Pubmed|8145641]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8145641], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|8145641]
  • view in new tab

    Biological materials

    Mutant

  • BKE30950 (Δ[gene|EBEA85AD543B79C321CB5F28D1B7E1248640DC1D|glgA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCTGACACAGCAAATAATA, downstream forward: _UP4_GAGCAGGTGACAAGGAGTGG
  • BKK30950 (Δ[gene|EBEA85AD543B79C321CB5F28D1B7E1248640DC1D|glgA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCTGACACAGCAAATAATA, downstream forward: _UP4_GAGCAGGTGACAAGGAGTGG
  • References

  • 8145641,19244233