SubtiBank SubtiBank
recF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

recF

promoter of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair center assembly
locus
BSU_00040
pI
7.01
mw
42.15 kDa
protein length
370 aa Sequence Blast
gene length
1113 bp Sequence Blast
function
[category|SW 3.1.5|DNA repair/ recombination]
product
promoter of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair center assembly
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    3,437 → 4,549

    Phenotypes of a mutant

  • drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
  • The protein

    Catalyzed reaction/ biological activity

  • increases the efficiency of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair center assembly [Pubmed|24891441]
  • Protein family

  • RecF family (single member, according to UniProt)
  • Structure

  • [PDB|5Z67] (from Thermoanaerobacter tengcongensis, 33% identity) [pubmed|29391496]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|FB1C21A94697E5B9D29C0F3B9C9F36E57BCBD237|yaaA]-[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]-[gene|CBC76FB453569550F14FE5015C05D45985C04979|remB]-[gene|AA42910B71348EFEA4165CFFCEF1E497897B9DDC|gyrB]-[gene|B207C7328177924B16F1C606F667BEADF12CA069|gyrA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2987848], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE00040 (Δ[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATATACAATCAGTGTCACC, downstream forward: _UP4_AAGTGAAGAAATGAGGTGAG
  • BKK00040 (Δ[gene|EBE03AEC7EC594A3115A7A72194BDFF300AA0BFA|recF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATATACAATCAGTGTCACC, downstream forward: _UP4_AAGTGAAGAAATGAGGTGAG
  • References

    Reviews

  • 22933559
  • Original publications

  • 2987848,15186413,9207023,24285298,24891441,1716726,1909186,8510642,29391496