SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


subunit of the regulatory iron-sulfur containing [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex, required for [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] dependent maturation of polycistronic mRNAs, control of the [SW|phosphorelay], required for the achieving a sufficient level of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]-P for [SW|sporulation] initiation
31.07 kDa
protein length
275 aa Sequence Blast
gene length
828 bp Sequence Blast
control of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] activity, see [SW|Targets of the Y complex]
subunit of the regulatory iron-sulfur containing [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|Other protein controlling the activity of the phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|Other protein controlling the activity of the phosphorelay]
  • Gene

    41,657 → 42,484

    Phenotypes of a mutant

  • block of [SW|sporulation] at stage 0 [Pubmed|12270811]
  • strongly reduced [SW|genetic competence], strongly reduced [SW|sporulation] [Pubmed|23490197]
  • defective in [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-mediated maturation of polycistronic mRNAs, see [SW|Targets of the Y complex] [pubmed|29794222]
  • The protein

    Catalyzed reaction/ biological activity

  • the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex acts as specificity factor for [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-dependent processing of polycistronic mRNAs, see [SW|Targets of the Y complex] [pubmed|29794222]
  • the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex stimulates [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] phosphorylation in the [category|SW 4.2.2|phosphorelay] [pubmed|27501195]
  • [SW|Domains]

  • PSP1 C-terminal domain (aa 61-146) (according to UniProt)
  • [SW|Cofactors]

  • two 4Fe-4S clusters (fully co-ordinates one cluster and contributes to the co-ordination of the second (with [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA] and [protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF])) [pubmed|31530674,28295778]
  • [SW|Localization]

  • cytoplasm [pubmed|27501195]
  • cell periphery, depending on [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • Expression and Regulation


    view in new tab



  • expressed during growth and the transition phase, expression is erduced in stationary phase [Pubmed|23490197]
  • view in new tab

    view in new tab

    additional information

  • 600,000/ 11,500 molecules per cell during growth in LB/ minimal medium [pubmed|31530674]
  • Biological materials


  • MGNA-B899 (ricT::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00320 (Δ[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]::erm trpC2) available at [ BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_GACACCAATTACATTGTACA, downstream forward: _UP4_ACAGATTAACGAGGTGTGGA
  • BKK00320 (Δ[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACACCAATTACATTGTACA, downstream forward: _UP4_ACAGATTAACGAGGTGTGGA
  • References

  • 12270811,23490197,22383849,26434553,28295778,27501195,29794222,31530674