SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


S-(2-succino)cysteine N-acetyltransferase
18.88 kDa
protein length
165 aa Sequence Blast
gene length
498 bp Sequence Blast
utilization and detoxification of S-(2-succino)cysteine
S-(2-succino)cysteine N-acetyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|Conversion of S-(2-succino)cysteine to cysteine]
  • [category|SW 2|Metabolism] → [category|SW 2.7|Detoxification reactions]
  • Gene

    4,060,307 → 4,060,804

    Phenotypes of a mutant

  • the ''[gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA] [gene|EBC2B9107AD50DD8F8174FC0BE4AD90DEE6A7CCA|snaB]'' double mutant does not grow with S-methyl cysteine [Pubmed|23944997]
  • no growth with S-(2-succino)cysteine as the single source of sulfur [pubmed|29626092]
  • resistant to S-(2-succino)cysteine toxicity [pubmed|29626092]
  • RNA

    Catalyzed reaction/ biological activity

  • acetylation of S-(2-succino)cysteine [pubmed|29626092]
  • The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|SnaA]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16513748], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]) [Pubmed|16513748]
  • additional information

  • the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • MGNA-B781 (yxeL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39510 (Δ[gene|EBC2B9107AD50DD8F8174FC0BE4AD90DEE6A7CCA|snaB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCGTGGCTTCATCTAGCGTT, downstream forward: _UP4_TAAAAATAGAAAAGGCGGGA
  • BKK39510 (Δ[gene|EBC2B9107AD50DD8F8174FC0BE4AD90DEE6A7CCA|snaB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCGTGGCTTCATCTAGCGTT, downstream forward: _UP4_TAAAAATAGAAAAGGCGGGA
  • References

  • 10746760,15937167,16513748,21815947,23944997,29626092