SubtiBank SubtiBank
yitA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yitA

sulfate adenylyltransferase
locus
BSU10920
pI
7.55
mw
43.09 kDa
protein length
389 aa Sequence Blast
gene length
1170 bp Sequence Blast
function
sulfate reduction and activation
product
sulfate adenylyltransferase
essential
no
ec
2.7.7.4
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,170,473 → 1,171,642

    The protein

    Catalyzed reaction/ biological activity

  • ATP + sulfate = diphosphate + adenylyl sulfate (according to Swiss-Prot)
  • Protein family

  • sulfate adenylyltransferase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|Sat]
  • Structure

  • [PDB|1R6X] (from yeast, 41% identity) [pubmed|14983089]
  • Expression and Regulation

    Operons

    genes
    [gene|E5090587E23B284EF3B3D8F3EA5C44CB86EEB82E|yitB]-[gene|EBBA4432FF83B6F203C694E04111D45290BE157A|yitA]-[gene|FE2B31E5EBE6C4BA4FC4AAC485A00C97315E6AAB|yisZ]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A500 (yitA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/500 NBRP B. subtilis, Japan]
  • BKE10920 (Δ[gene|EBBA4432FF83B6F203C694E04111D45290BE157A|yitA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTGTTCAACCTCCATT, downstream forward: _UP4_AAGCAAAACAGCGGGGAATT
  • BKK10920 (Δ[gene|EBBA4432FF83B6F203C694E04111D45290BE157A|yitA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTGTTCAACCTCCATT, downstream forward: _UP4_AAGCAAAACAGCGGGGAATT
  • References

  • 15699190,15383836,14983089