SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


sulfate adenylyltransferase
43.09 kDa
protein length
389 aa Sequence Blast
gene length
1170 bp Sequence Blast
sulfate reduction and activation
sulfate adenylyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    1,170,473 → 1,171,642

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H+ + sulfate --> adenosine 5'-phosphosulfate + diphosphate (according to UniProt)
  • Protein family

  • sulfate adenylyltransferase family (with [protein|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|Sat], according to UniProt)
  • Paralogous protein(s)

  • [protein|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|Sat]
  • Structure

  • [PDB|1R6X] (from yeast, 41% identity) [pubmed|14983089]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,15383836]
  • view in new tab

    Biological materials


  • MGNA-A500 (yitA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10920 (Δ[gene|EBBA4432FF83B6F203C694E04111D45290BE157A|yitA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTGTTCAACCTCCATT, downstream forward: _UP4_AAGCAAAACAGCGGGGAATT
  • BKK10920 (Δ[gene|EBBA4432FF83B6F203C694E04111D45290BE157A|yitA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTGTTCAACCTCCATT, downstream forward: _UP4_AAGCAAAACAGCGGGGAATT
  • References

  • 15699190,15383836,14983089