SubtiBank SubtiBank


flagellar basal-body M-ring protein, membrane anchor of the basal body
59.13 kDa
protein length
536 aa Sequence Blast
gene length
1611 bp Sequence Blast
movement and chemotaxis
flagellar basal-body M-ring protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for efficient pellicle biofilm formation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,692,496 → 1,694,106

    Phenotypes of a mutant

  • mucoid phenotype due to the overproduction of poly-gamma-glutamate [Pubmed|24296669]
  • no secretion of [protein|F03144BF8A187C8931938A21433431B8961E8EE7|FlgM], permanent inhibition of [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD] [Pubmed|25313396]
  • inactivation of ''[gene|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]'' confers resistance to high concentrations of Zn(II) [Pubmed|27935957]
  • not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
  • The protein

    Catalyzed reaction/ biological activity

  • required for correct localization of [protein|1D51AF3E6456F126203D7C7273FB828A47E26DFB|FliM] [Pubmed|23190039]
  • Protein family

  • FliF family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • DS7080 (marker-less in NCIB3610) [Pubmed|24296669]
  • BKE16210 (Δ[gene|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTAACCCCCGGTCATT, downstream forward: _UP4_GCCGAGGATTAGGAGGAATT
  • BKK16210 (Δ[gene|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTAACCCCCGGTCATT, downstream forward: _UP4_GCCGAGGATTAGGAGGAATT
  • References


  • 26490009
  • Original publications

  • 26122431,1905667,17850253,14651647,18763711,9657996,8157612,15175317,23190039,24296669,25313396,24386445,25843804,27935957,30201778