SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


2-keto-3-deoxygluconate permease
34.16 kDa
protein length
330 aa Sequence Blast
gene length
993 bp Sequence Blast
utilization of galacturonic acid
2-keto-3-deoxygluconate permease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of hexuronate]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,321,972 → 2,322,964

    The protein

    Protein family

  • KdgT transporter family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9846747], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR]: repression, [Pubmed|9846747], in [regulon|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|9846747], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galacturonate ([protein|891A32A19D1353BA566FF121BBCA7B986D31D129|KdgR]) [Pubmed|9846747]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials


  • BKE22090 (Δ[gene|EB6F40F8651654E0AB09447C5AD670C35A59F261|kdgT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGTGGATTCTCCCAT, downstream forward: _UP4_TGAATAAAAAGGCTGCCACA
  • BKK22090 (Δ[gene|EB6F40F8651654E0AB09447C5AD670C35A59F261|kdgT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGTGGATTCTCCCAT, downstream forward: _UP4_TGAATAAAAAGGCTGCCACA
  • References

  • 9846747