SubtiBank SubtiBank
cotU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cotU

outer spore coat protein
locus
BSU_17670
pI
6.32
mw
11.42 kDa
protein length
gene length
261 bp Sequence Blast
function
resistance of the spore
product
outer spore coat protein
essential
no
synonyms
ynzH

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.7|Class VI]
  • Gene

    Coordinates
    1,901,117 → 1,901,377

    The protein

    Paralogous protein(s)

  • [protein|9C59B51FC19FC83BD14272008BD441833DD1738E|CotC]
  • [SW|Localization]

  • outer spore coat, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814]
  • the [protein|9C59B51FC19FC83BD14272008BD441833DD1738E|CotC]-[protein|EB690FA075EAC3E298C47AED082B5FC21E8F8F46|CotU] complex assembles around the forming spore [Pubmed|18065538]
  • Expression and Regulation

    Operons

    genes
    [gene|EB690FA075EAC3E298C47AED082B5FC21E8F8F46|cotU]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|18065538], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|18065538], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: repression, [Pubmed|20435725], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|18065538]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A021 (ynzH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/21 NBRP B. subtilis, Japan]
  • BKE17670 (Δ[gene|EB690FA075EAC3E298C47AED082B5FC21E8F8F46|cotU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAAATTCCTCCTTTAT, downstream forward: _UP4_TAAATCTCTTAAACGTCTAT
  • BKK17670 (Δ[gene|EB690FA075EAC3E298C47AED082B5FC21E8F8F46|cotU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAAATTCCTCCTTTAT, downstream forward: _UP4_TAAATCTCTTAAACGTCTAT
  • References

    Reviews

  • 27227299
  • Original Publications

  • 18065538,12562816,20023017,20435725,22171814,26953338