SubtiBank SubtiBank
ypzC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ypzC

unknown
locus
BSU_23320
pI
7.89
mw
8.72 kDa
protein length
gene length
237 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,433,137 → 2,433,373

    Biological materials

    Mutant

  • BKE23320 (Δ[gene|EB685771F9D6396A153CED0800709CB0988C83E5|ypzC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACTGCCCGTAACCTCAT, downstream forward: _UP4_TCATTCAAGCTCGAAAACAT
  • BKK23320 (Δ[gene|EB685771F9D6396A153CED0800709CB0988C83E5|ypzC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACTGCCCGTAACCTCAT, downstream forward: _UP4_TCATTCAAGCTCGAAAACAT