SubtiBank SubtiBank
sacY
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sacY

transcriptional antiterminator for [gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB] and [gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]-[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY] (acts at high sucrose concentrations)
locus
BSU38420
pI
5.88
mw
32.31 kDa
protein length
280 aa Sequence Blast
gene length
843 bp Sequence Blast
function
regulation of sucrose utilization
product
transcriptional antiterminator
essential
no
synonyms
ipa-13r,sacS

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.19|Utilization of sucrose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.3|PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    3,943,667 → 3,944,509

    The protein

    Catalyzed reaction/ biological activity

  • binding to the mRNA of'' [gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]'' and the ''[gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]-[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]'' operon, causes transcription antitermination (in presence of sucrose)
  • Protein family

  • [PRD-containing transcription factors|search|transcriptional antiterminator] bglG family (according to Swiss-Prot) BglG family of antiterminators
  • Paralogous protein(s)

  • [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT], [protein|6796E1C147AA21E919A42A953884DC24E182F430|SacT], [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]
  • [SW|Domains]

  • N-terminal RNA binding domain [Pubmed|10610766]
  • 2 x [SW|PRD] ([protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] regulation domains) [Pubmed|9663674]
  • Structure

  • [PDB|1AUU] (RNA-binding domain)
  • Expression and Regulation

    Operons

    genes
    [gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]-[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]
    description
    [Pubmed|2116367]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1400159], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|1400159], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY]: antitermination, in [regulon|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY regulon]
  • regulation

  • induction by sucrose (at high concentration) [Pubmed|8535520]
  • view in new tab

    Biological materials

    Mutant

  • GP425 (cat), available in [SW|Jörg Stülke]'s lab
  • BKE38420 (Δ[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTTTTTGTCCTTTC, downstream forward: _UP4_TGAGACAAACAAAAAACGCT
  • BKK38420 (Δ[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTTTTTGTCCTTTC, downstream forward: _UP4_TGAGACAAACAAAAAACGCT
  • Expression vectors

  • for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP316, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP573, available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1226 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1222 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

    Reviews

  • 9663674,18086213
  • Original publications

  • 2105292,8702561,11580842,1279678,9305643,9305644,9202047,10610766,2116367,1400159,8535520,21278164,23303779,12079345