SubtiBank SubtiBank
sacY

sacY

transcriptional antiterminator for [gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB] and [gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]-[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY] (acts at high sucrose concentrations)
locus
BSU_38420
pI
5.88
mw
32.31 kDa
protein length
280 aa Sequence Blast
gene length
843 bp Sequence Blast
function
regulation of sucrose utilization
product
transcriptional antiterminator
essential
no
synonyms
ipa-13r,sacS

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.19|Utilization of sucrose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.3|PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    3,943,667 → 3,944,509

    The protein

    Catalyzed reaction/ biological activity

  • binding to the mRNA of'' [gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]'' and the ''[gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]-[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]'' operon, causes transcription antitermination (in presence of sucrose)
  • Protein family

  • [SW|PRD-containing transcription factors]
  • Paralogous protein(s)

  • [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT], [protein|6796E1C147AA21E919A42A953884DC24E182F430|SacT], [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]
  • [SW|Domains]

  • N-terminal RNA binding domain [Pubmed|10610766]
  • 2 x [SW|PRD] ([protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] regulation domains) [Pubmed|9663674]
  • 2 [SW|PRD] domains (aa 64-169, aa 170-280) (according to UniProt)
  • Structure

  • [PDB|1AUU] (RNA-binding domain)
  • Expression and Regulation

    Operons

    genes
    [gene|531F132F7F6A878F1E1D56977B9898A14272349A|sacX]-[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]
    description
    [Pubmed|2116367]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1400159], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|1400159], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY]: antitermination, in [regulon|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY regulon]
  • regulation

  • induction by sucrose (at high concentration) [Pubmed|8535520]
  • view in new tab

    Biological materials

    Mutant

  • GP425 (cat), available in [SW|Jörg Stülke]'s lab
  • BKE38420 (Δ[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTTTTTGTCCTTTC, downstream forward: _UP4_TGAGACAAACAAAAAACGCT
  • BKK38420 (Δ[gene|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTTTTTGTCCTTTC, downstream forward: _UP4_TGAGACAAACAAAAAACGCT
  • Expression vectors

  • for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP316, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP573, available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1226 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1222 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

    Reviews

  • 9663674,18086213
  • Original publications

  • 2105292,8702561,11580842,1279678,9305643,9305644,9202047,10610766,2116367,1400159,8535520,21278164,23303779,12079345