SubtiBank SubtiBank
yqjM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqjM

NADPH-dependent flavin oxidoreductase
locus
BSU23820
pI
5.14
mw
37.43 kDa
protein length
338 aa Sequence Blast
gene length
1017 bp Sequence Blast
function
reduction of double bonds of nonsaturated aldehydes
product
NADPH-dependent flavin oxidoreductase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,475,843 → 2,476,859

    The protein

    Catalyzed reaction/ biological activity

  • NADPH + acceptor = NADP+ + reduced acceptor (according to Swiss-Prot)
  • Protein family

  • NADH:flavin oxidoreductase/NADH oxidase family (according to UniProt) (with [protein|9DC6FD87D1AF7CD2F41738E04C4D6DCD6F6276E5|YqiG])
  • Paralogous protein(s)

  • [protein|9DC6FD87D1AF7CD2F41738E04C4D6DCD6F6276E5|YqiG]
  • [SW|Cofactors]

  • FMN [pubmed|15890652]
  • Structure

  • [PDB|1Z41] (oxidized form), [PDB|1Z48] (reduced form) [pubmed|15890652]
  • Expression and Regulation

    Operons

    genes
    [gene|EB17629B7598C62741072E1AF0AB715C02041B70|yqjM]
    description
    [Pubmed|22383849]

    regulation

  • induced in the presence of H2O2 [Pubmed|12660247]
  • view in new tab

    Biological materials

    Mutant

  • BKE23820 (Δ[gene|EB17629B7598C62741072E1AF0AB715C02041B70|yqjM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTCGCCTCCCGTA, downstream forward: _UP4_TAATGCCCATAAGAGATATC
  • BKK23820 (Δ[gene|EB17629B7598C62741072E1AF0AB715C02041B70|yqjM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTCGCCTCCCGTA, downstream forward: _UP4_TAATGCCCATAAGAGATATC
  • References

    Reviews

  • 25940546
  • Original publications

  • 12660247,15249051,15890652,26521678,30379645,30645192