SubtiBank SubtiBank
yqjM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqjM

NADPH-dependent flavin oxidoreductase
locus
BSU_23820
pI
5.14
mw
37.43 kDa
protein length
338 aa Sequence Blast
gene length
1017 bp Sequence Blast
function
reduction of double bonds of nonsaturated aldehydes
product
NADPH-dependent flavin oxidoreductase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,475,843 → 2,476,859

    The protein

    Catalyzed reaction/ biological activity

  • A + H+ + NADPH --> AH2 + NADP+ (according to UniProt)
  • Protein family

  • NADH:flavin oxidoreductase/NADH oxidase family (with [protein|9DC6FD87D1AF7CD2F41738E04C4D6DCD6F6276E5|YqiG], according to UniProt)
  • Paralogous protein(s)

  • [protein|9DC6FD87D1AF7CD2F41738E04C4D6DCD6F6276E5|YqiG]
  • [SW|Cofactors]

  • FMN [pubmed|15890652]
  • Structure

  • [PDB|1Z41] (oxidized form), [PDB|1Z48] (reduced form) [pubmed|15890652]
  • Expression and Regulation

    Operons

    genes
    [gene|EB17629B7598C62741072E1AF0AB715C02041B70|yqjM]
    description
    [Pubmed|22383849]

    regulation

  • induced in the presence of H2O2 [Pubmed|12660247]
  • view in new tab

    Biological materials

    Mutant

  • BKE23820 (Δ[gene|EB17629B7598C62741072E1AF0AB715C02041B70|yqjM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTCGCCTCCCGTA, downstream forward: _UP4_TAATGCCCATAAGAGATATC
  • BKK23820 (Δ[gene|EB17629B7598C62741072E1AF0AB715C02041B70|yqjM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTCGCCTCCCGTA, downstream forward: _UP4_TAATGCCCATAAGAGATATC
  • References

    Reviews

  • 25940546
  • Original publications

  • 12660247,15249051,15890652,26521678,30379645,30645192