SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


GTPase, nucleotide-binding protein, similar to RNase adaptor protein
33.70 kDa
protein length
295 aa Sequence Blast
gene length
888 bp Sequence Blast
required for the expression of late competence genes

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    3,571,501 → 3,572,388

    Phenotypes of a mutant

  • reduced [SW|genetic competence] [Pubmed|19074378]
  • The protein

    Catalyzed reaction/ biological activity

  • binds and hydrolyzes nucleotides, required for the expression of late competence genes (''[gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK], [gene|4D76F07D6124D56C7CEBBDAB9E84B2718BF1E7FC|comS]'') [Pubmed|19074378]
  • Protein family

  • RapZ-like family (single member, according to UniProt)
  • Structure

  • [PDB|5O5Q] (RapZ from E. coli, 41% identity) [pubmed|28977623]
  • [SW|Localization]

  • can be localized in the cell either as a helical-like pattern or as foci close to the poles and the septa depending on growth phase and on growth medium [Pubmed|21709426]
  • Additional information

  • [$=genesensor5&logdbfrom=pubmed Information on the ''E. coli'' homolog]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16272399], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • constitutive expression at both protein and RNA levels [Pubmed|24097947,22383849]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yvcI]' and '[protein|search|trxB]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • MGNA-B641 (yvcJ::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A885 ( ''yvcJ''::''cat''), [Pubmed|19074378], available at [ BGSC]
  • BKE34770 (Δ[gene|EB12C6B4F36B57BF0C59CE048CBAE18734C78D35|yvcJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTCTCCCCCCTGACT, downstream forward: _UP4_ATTGAAAAGAGAAGCCGGAA
  • BKK34770 (Δ[gene|EB12C6B4F36B57BF0C59CE048CBAE18734C78D35|yvcJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTCTCCCCCCTGACT, downstream forward: _UP4_ATTGAAAAGAGAAGCCGGAA
  • Expression vectors

  • pGP735 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Stülke] lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW| Görke] lab
  • labs

  • [SW|Anne Galinier], University of Marseille, France
  • References

    Original publications

  • 9237995,16272399,19074378,21709426
  • Publications on the ''E. coli'' homolog

  • 17824929,28977623,24667238,23475961