SubtiBank SubtiBank
rpmH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rpmH

ribosomal protein
locus
BSU_41060
pI
13.00
mw
5.00 kDa
protein length
gene length
135 bp Sequence Blast
function
translation
product
ribosomal protein L34
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    4,215,255 → 4,215,389

    Phenotypes of a mutant

  • severe slow-growth phenotype, suppressed by disruption of ''[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|yhdP]'' or overexpression of ''[gene|472E3A2407C83EEE26DB00079D185C4EA2988611|mgtE]'' [Pubmed|25182490]
  • increased fraction of hyperpolarized cells (35.2% vs. 3.7% in the wild type) [pubmed|30853217]
  • the [SW|ribosome]s are destabilized [pubmed|25182490]
  • The protein

    Catalyzed reaction/ biological activity

  • required for efficient 70S-[SW|ribosome] formation [Pubmed|25182490]
  • Protein family

  • bacterial [SW|ribosomal protein] bL34 family (single member, according to UniProt)
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • [SW|Localization]

  • [SW|ribosome]
  • Expression and Regulation

    Operons

    genes
    [gene|EB07AECD3849CC0B65126DE27E71B28B3AD106B0|rpmH]
    description
    [Pubmed|2987847]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2987848], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    genes
    [gene|EB07AECD3849CC0B65126DE27E71B28B3AD106B0|rpmH]-[gene|594F2D36BE71A45303A33AA2A2931F56F0A969ED|rnpA]-[gene|D40C202E67A5319A91811DB11356F47A56C97DD2|spoIIIJ]-[gene|23D33E2D7AB1CA02165070DB8238957E3C768E64|jag]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKK41060 (Δ[gene|EB07AECD3849CC0B65126DE27E71B28B3AD106B0|rpmH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK41060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGACACCTCCCTCG, downstream forward: _UP4_TAGGCCACTGAATAATGTCA
  • References

  • 19653700,2987847,2987848,20525796,23002217,25182490,25903689,30853217