SubtiBank SubtiBank
yhdF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhdF

similar to glucose 1-dehydrogenase
locus
BSU_09450
pI
5.16
mw
31.36 kDa
protein length
289 aa Sequence Blast
gene length
870 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,022,231 → 1,023,100

    The protein

    Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0DD474462720CAEE2AE17017BD7CA385238EBC6F|YxbG], [protein|0FD332269D2D6103E57ACE719E39977C68E38F0A|YvrD], [protein|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|BacC], [protein|248F0805272FED9B38ECBB31E2872BC9EC163CE0|YmfI], [protein|3161519994609DA9360ED6E073E4A4C8C6210EFB|YdaD], [protein|439B468A13137000FB42E9389391CB4986FFED84|FabG], [protein|6BA346D8A7B496F9618AFAB4FEEF4BD1A41D2C7E|YoxD], [protein|CA4597C6253CCF7D7954686A30AF041808BDF8E5|Gdh], [protein|CE990D33A12C50D22506A52E0099F7D97A762D4E|FadH]
  • [protein|FBBDE1E058223D5E8CEB07CAA50940A329C809E4|KduD]:
  • [protein|4DEFC2998464BF8327578C36A13A10DD277F991E|YkvO]:
  • [protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|YhxC]:
  • [protein|739B228743BC1FE9E6888E999BC0E4F615E36F9E|YhxD]:
  • [protein|B6FF689E65906186F3576B378650D713DB84EDDA|YcdF]:
  • [protein|D9D1FCBFC62F93CAA34DF61A784406F4E9EE6768|YjdA]:
  • [protein|5964B6E817260DA7937796DDFA753A665A04D650|FabL]:
  • [protein|0DD474462720CAEE2AE17017BD7CA385238EBC6F|YxbG] (36.1%), [protein|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|BacC] (37.8%), [protein|439B468A13137000FB42E9389391CB4986FFED84|FabG] (31.6%), [protein|4DEFC2998464BF8327578C36A13A10DD277F991E|YkvO] (34.3%), [protein|FBBDE1E058223D5E8CEB07CAA50940A329C809E4|KduD] (33.1%), [protein|CE990D33A12C50D22506A52E0099F7D97A762D4E|FadH] (31.1%), [protein|248F0805272FED9B38ECBB31E2872BC9EC163CE0|YmfI] (30,6%), [protein|D9D1FCBFC62F93CAA34DF61A784406F4E9EE6768|YjdA] (33.6%), [protein|6BA346D8A7B496F9618AFAB4FEEF4BD1A41D2C7E|YoxD] (31.9%), [protein|5964B6E817260DA7937796DDFA753A665A04D650|FabL] (30.1%), [protein|0FD332269D2D6103E57ACE719E39977C68E38F0A|YvrD] (30.2%)
  • Structure

  • [PDB|3I30] (from Bacillus anthracis str. amesAncestor, 66% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    genes
    [gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]-[gene|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8045898], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|CitR]: repression, [Pubmed|8045899], in [regulon|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|CitR regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B478 (yhdF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1477 NBRP B. subtilis, Japan]
  • BKE09450 (Δ[gene|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTCATCACTCCTAGAC, downstream forward: _UP4_TAATCAACGAAAAACCAGCT
  • BKK09450 (Δ[gene|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTCATCACTCCTAGAC, downstream forward: _UP4_TAATCAACGAAAAACCAGCT
  • References

  • 11544224