deaD [2019-07-05 11:07:43]

DEAD-box RNA helicase

locus: BSU39110

pI: 7.71

mw: 53.85 kDa

protein length: 479 aa

gene length: 1440 bp

function: RNA helicase

product: DEAD-box RNA helicase

essential: no

synonyms: yxiN

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.3|DEAD-box RNA helicases]
• [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]

Gene

Coordinates: 4,015,987 → 4,017,426

The protein

Catalyzed reaction/ biological activity

• RNA helicase

Protein family

• [SW|helicase family] (according to UniProt)
• [SW|DEAD-box RNA helicases]

Paralogous protein(s)

• [protein|0362D937D985846AEE4D0DEA57B62F915E8D35E5|YfmL], [protein|C83BD80DE0FD187D07B914F64696438ED5130107|CshB], [protein|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|CshA]

[SW|Domains]

• Helicase domain 1: AS 1-203
• Linker region: AS 204-212
• Helicase domain 2: AS 207-368
• RNA-binding domain: AS 404-479

Structure

• [PDB|5IVL] (from Geobacillus stearothermophilus, corresponds to aa 1 ... 373, 44% identity) [pubmed|28238534]
• [PDB|2G0C] (RNA-binding domain, AA 404-479)
• [PDB|2HJV] (second domain, AA 207-368)
• [PDB|3MOJ] (RNA binding domain complexed with a fragment of 23S ribosomal RNA) [Pubmed|20673833]

Expression and Regulation

Operons

• genes: [gene|D2790591E8C3B86BF91F6E1B6DADBA306D5EF758|yxiM]-[gene|EACD0C84AA3CE41EF05EAA3D25AA1153293EB562|deaD]
  description: [Pubmed|10746760]

  regulation

  • expression declines in the stationary phase [Pubmed|23175651]

Biological materials

Mutant

• MGNA-B720 (deaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1719 NBRP B. subtilis, Japan]
• GP1052 (Δ[gene|EACD0C84AA3CE41EF05EAA3D25AA1153293EB562|deaD]::tet), available in [SW|Jörg Stülke]'s lab
• BKE39110 (Δ[gene|EACD0C84AA3CE41EF05EAA3D25AA1153293EB562|deaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATAAACTCCTGTCTC, downstream forward: _UP4_AAATGATGAATGACCTGCTC
• BKK39110 (Δ[gene|EACD0C84AA3CE41EF05EAA3D25AA1153293EB562|deaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATAAACTCCTGTCTC, downstream forward: _UP4_AAATGATGAATGACCTGCTC

Expression vectors

• for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], expression from the native chromomsomal site: GP1065 (spc), available in [SW|Jörg Stülke]'s lab

two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|20572937]

FLAG-tag construct

• GP1068 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab

labs

• [SW|Dagmar Klostermeier], Biozentrum Basel, Switzerland [http://www.biozentrum.unibas.ch/klostermeier/index.html homepage]

References

• 17142894,16118224,17229151,16611943,19839642,19474341,18184816,17951299,12460566,10481020,20572937,20673833,20691700,23175651,23625962,25907111,25123660,28238534,30337909