product
DEAD-box RNA helicase
Genomic Context
categories
[category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.3|DEAD-box RNA helicases][category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]Gene
Coordinates
4,015,987 → 4,017,426
The protein
Catalyzed reaction/ biological activity
RNA helicaseATP + H2O --> ADP + H+ + phosphate (according to UniProt)Protein family
[SW|helicase family] (according to UniProt)[SW|DEAD-box RNA helicases] (according to UniProt)Paralogous protein(s)
[protein|0362D937D985846AEE4D0DEA57B62F915E8D35E5|YfmL], [protein|C83BD80DE0FD187D07B914F64696438ED5130107|CshB], [protein|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|CshA] [SW|Domains]
[SW|Helicase ATP-binding domain] (aa 33-203) (according to UniProt)[SW|Helicase C-terminal domain] (aa 214-374) (according to UniProt)Structure
[PDB|5IVL] (from Geobacillus stearothermophilus, corresponds to aa 1 ... 373, 44% identity) [pubmed|28238534][PDB|2G0C] (RNA-binding domain, AA 404-479)[PDB|2HJV] (second domain, AA 207-368)[PDB|3MOJ] (RNA binding domain complexed with a fragment of 23S ribosomal RNA) [Pubmed|20673833]Biological materials
Mutant
MGNA-B720 (deaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1719 NBRP B. subtilis, Japan]GP1052 (Δ[gene|EACD0C84AA3CE41EF05EAA3D25AA1153293EB562|deaD]::tet), available in [SW|Jörg Stülke]'s labBKE39110 (Δ[gene|EACD0C84AA3CE41EF05EAA3D25AA1153293EB562|deaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATAAACTCCTGTCTC, downstream forward: _UP4_AAATGATGAATGACCTGCTCBKK39110 (Δ[gene|EACD0C84AA3CE41EF05EAA3D25AA1153293EB562|deaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATAAACTCCTGTCTC, downstream forward: _UP4_AAATGATGAATGACCTGCTCExpression vectors
for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], expression from the native chromomsomal site: GP1065 (spc), available in [SW|Jörg Stülke]'s labtwo-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|20572937]FLAG-tag construct
GP1068 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lablabs
[SW|Dagmar Klostermeier], Biozentrum Basel, Switzerland [http://www.biozentrum.unibas.ch/klostermeier/index.html homepage]References
17142894,16118224,17229151,16611943,19839642,19474341,18184816,17951299,12460566,10481020,20572937,20673833,20691700,23175651,23625962,25907111,25123660,28238534,30337909