SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


DEAD-box RNA helicase
53.85 kDa
protein length
479 aa Sequence Blast
gene length
1440 bp Sequence Blast
RNA helicase
DEAD-box RNA helicase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.3|DEAD-box RNA helicases]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Translation/ other]
  • Gene

    4,015,987 → 4,017,426

    The protein

    Catalyzed reaction/ biological activity

  • RNA helicase
  • ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|helicase family] (according to UniProt)
  • [SW|DEAD-box RNA helicases] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0362D937D985846AEE4D0DEA57B62F915E8D35E5|YfmL], [protein|C83BD80DE0FD187D07B914F64696438ED5130107|CshB], [protein|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|CshA]
  • [SW|Domains]

  • [SW|Helicase ATP-binding domain] (aa 33-203) (according to UniProt)
  • [SW|Helicase C-terminal domain] (aa 214-374) (according to UniProt)
  • Structure

  • [PDB|5IVL] (from Geobacillus stearothermophilus, corresponds to aa 1 ... 373, 44% identity) [pubmed|28238534]
  • [PDB|2G0C] (RNA-binding domain, AA 404-479)
  • [PDB|2HJV] (second domain, AA 207-368)
  • [PDB|3MOJ] (RNA binding domain complexed with a fragment of 23S ribosomal RNA) [Pubmed|20673833]
  • Expression and Regulation




  • expression declines in the stationary phase [Pubmed|23175651]
  • view in new tab

    Biological materials


  • MGNA-B720 (deaD::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1052 (Δ[gene|EACD0C84AA3CE41EF05EAA3D25AA1153293EB562|deaD]::tet), available in [SW|Jörg Stülke]'s lab
  • BKE39110 (Δ[gene|EACD0C84AA3CE41EF05EAA3D25AA1153293EB562|deaD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATAAACTCCTGTCTC, downstream forward: _UP4_AAATGATGAATGACCTGCTC
  • BKK39110 (Δ[gene|EACD0C84AA3CE41EF05EAA3D25AA1153293EB562|deaD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATAAACTCCTGTCTC, downstream forward: _UP4_AAATGATGAATGACCTGCTC
  • Expression vectors

  • for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], expression from the native chromomsomal site: GP1065 (spc), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|20572937]
  • FLAG-tag construct

  • GP1068 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Dagmar Klostermeier], Biozentrum Basel, Switzerland [ homepage]
  • References

  • 17142894,16118224,17229151,16611943,19839642,19474341,18184816,17951299,12460566,10481020,20572937,20673833,20691700,23175651,23625962,25907111,25123660,28238534,30337909