The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywfA

similar to chloramphenicol resistance

locus: BSU_37750

pI: 9.19

mw: 44.39 kDa

protein length: 412 aa

gene length: 1239 bp

function: unknown

product: unknown

essential: no

synonyms: ipa-79d

Genomic Context

categories

• [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 3,874,332 → 3,875,570

The protein

Protein family

• [SW|major facilitator superfamily] (according to UniProt)

[SW|Localization]

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• genes: [gene|EA9A262EEC24BB159F0A6D207D0D88417B31027D|ywfA]
  description: [Pubmed|22383849]

Biological materials

Mutant

• MGNA-B670 (ywfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1669 NBRP B. subtilis, Japan]
• BKE37750 (Δ[gene|EA9A262EEC24BB159F0A6D207D0D88417B31027D|ywfA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTCTCAAACACCTC, downstream forward: _UP4_TAAACAAAGTTTCTAAATTC
• BKK37750 (Δ[gene|EA9A262EEC24BB159F0A6D207D0D88417B31027D|ywfA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTCTCAAACACCTC, downstream forward: _UP4_TAAACAAAGTTTCTAAATTC