SubtiBank SubtiBank


two-component sensor kinase, regulation of aerobic and anaerobic respiration
66.60 kDa
protein length
589 aa Sequence Blast
gene length
1770 bp Sequence Blast
regulation of aerobic and anaerobic respiration
two-component sensor kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.1|Regulators of electron transport]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    2,415,415 → 2,417,184

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • Paralogous protein(s)

  • [protein|C81F68521F17861D50926D7D8757DC1D2340BC0D|PhoR], [protein|E88978809272FAC2520DB4ABCA0554F8028F3451|WalK]
  • [SW|Domains]

  • two transmembrane segments
  • [SW|HAMP domain] (aa 194-246) (according to UniProt)
  • [SW|PAS domain] (aa 253-320) (according to UniProt)
  • [SW|Histidine kinase domain] (aa 371-589) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • Structure

  • [PDB|4ZR7] (N-terminal domain)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8631715], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [PubMed|8631715,11222591], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9988472], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16825793], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [,11222591 PubMed]
  • view in new tab



  • expressed under anaerobic conditions ([protein|search|ResD]) [,11222591 PubMed]
  • view in new tab

    Biological materials


  • BKE23110 (Δ[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTACTACGCTTTTCCAAA, downstream forward: _UP4_TAAAATCGAGTCTGAATTTG
  • BKK23110 (Δ[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTACTACGCTTTTCCAAA, downstream forward: _UP4_TAAAATCGAGTCTGAATTTG
  • References


  • 23046954
  • Original publications

  • 16885456,8631715,10094672,8682783,9352926,8631715,11222591,9988472,16825793,26297017,25909364,28899391