SubtiBank SubtiBank
yvdE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvdE

similar to transcriptional regulator ([SW|LacI family]), probably regulator of starch and maltodextrin utilization
locus
BSU_34630
pI
7.09
mw
35.28 kDa
protein length
316 aa Sequence Blast
gene length
951 bp Sequence Blast
function
probably regulation of starch and maltodextrin utilization
product
transcriptional regulator ([SW|LacI family])
essential
no
synonyms
mdxR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.23|Utilization of starch/ maltodextrin]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    3,557,784 → 3,558,734

    The protein

    Protein family

  • [SW|LacI family]
  • [SW|Domains]

  • [SW|HTH lacI-type domain] (aa 1-56) (according to UniProt)
  • Structure

  • [PDB|5YSZ] (from Thermobifida fusca, 30% identity) [pubmed|30062758]
  • Expression and Regulation

    Operons

    genes
    [gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]-[gene|A577441DE4ABAF624D507DB80FBED2A652BCF385|yvdF]-[gene|5771E1976D986638B13ADDE97EDE32709E355923|mdxE]-[gene|EA2DD9892C1128ADCD6C8BC61248EBE45339E6D6|mdxF]-[gene|D72CFFE8ED3EC0280AE92C05A136D66ED1F62251|mdxG]-[gene|68C6FD5D4D9491EE15A5015447959A45C36EA702|yvdJ]-[gene|5F615BB886EC4F7000AAD42258DB8E47616552DE|yvdK]-[gene|6E5AB4620F9A896C32CD77AF314C67035814AE0A|malL]-[gene|CAFAE305B1771DD89E81F75A6713161393BE99A0|pgcM]
    description
    [Pubmed|16707683]

    regulation

  • induced in the presence of maltose [Pubmed|9573215]
  • view in new tab

    Biological materials

    Mutant

  • BKE34630 (Δ[gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCCCTCCTTAT, downstream forward: _UP4_TAAGCGCCTTATTCTGTTAT
  • BKK34630 (Δ[gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCCCTCCTTAT, downstream forward: _UP4_TAAGCGCCTTATTCTGTTAT
  • References

  • 16707683,30062758