SubtiBank SubtiBank
yvdE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvdE

similar to transcriptional regulator ([SW|LacI family]), probably regulator of starch and maltodextrin utilization
locus
BSU34630
pI
7.09
mw
35.28 kDa
protein length
316 aa Sequence Blast
gene length
951 bp Sequence Blast
function
probably regulation of starch and maltodextrin utilization
product
transcriptional regulator ([SW|LacI family])
essential
no
synonyms
mdxR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.23|Utilization of starch/ maltodextrin]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    3,557,784 → 3,558,734

    The protein

    Protein family

  • [SW|LacI family]
  • Structure

  • [PDB|5YSZ] (from Thermobifida fusca, 30% identity) [pubmed|30062758]
  • Expression and Regulation

    Operons

    genes
    [gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]-[gene|A577441DE4ABAF624D507DB80FBED2A652BCF385|yvdF]-[gene|5771E1976D986638B13ADDE97EDE32709E355923|mdxE]-[gene|EA2DD9892C1128ADCD6C8BC61248EBE45339E6D6|mdxF]-[gene|D72CFFE8ED3EC0280AE92C05A136D66ED1F62251|mdxG]-[gene|68C6FD5D4D9491EE15A5015447959A45C36EA702|yvdJ]-[gene|5F615BB886EC4F7000AAD42258DB8E47616552DE|yvdK]-[gene|6E5AB4620F9A896C32CD77AF314C67035814AE0A|malL]-[gene|CAFAE305B1771DD89E81F75A6713161393BE99A0|pgcM]
    description
    [Pubmed|16707683]

    regulation

  • induced in the presence of maltose [Pubmed|9573215]
  • view in new tab

    Biological materials

    Mutant

  • BKE34630 (Δ[gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCCCTCCTTAT, downstream forward: _UP4_TAAGCGCCTTATTCTGTTAT
  • BKK34630 (Δ[gene|EA1BEC9FCFD2A32142A8A8E6D7362DB37E02052A|yvdE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCCCTCCTTAT, downstream forward: _UP4_TAAGCGCCTTATTCTGTTAT
  • References

  • 16707683,30062758