SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


L-threonylcarbamoyl-AMP synthase, biosynthesis of the hypermodified base threonylcarbamoyladenosine (t(6)A) (together with [protein|6CB350C335603D5F4434679F9D740BFECA738599|TsaB]-[protein|30393F16CFE89E7BAD233A0BD27B77D679F7E409|TsaD]-[protein|E15BB518649B2B9CD44CEBBB4FA481E55BCE823C|TsaE])
36.85 kDa
protein length
346 aa Sequence Blast
gene length
1041 bp Sequence Blast
tRNA modification
L-threonylcarbamoyl-AMP synthase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    3,792,969 → 3,794,009

    Phenotypes of a mutant

  • poor growth [pubmed|28189581]
  • poorly transformable [pubmed|28189581]
  • restores viability of a ''[gene|0136394A52759CEEDD8DE074ED74033C6FFB8435|smc]'' mutant on rich medium due to the induction of a [SW|stringent response] [Pubmed|26539825]
  • The protein

    Catalyzed reaction/ biological activity

  • conversion of L-threonine, bicarbonate/CO2 and ATP to give the intermediate L-threonylcarbamoyl-AMP (TC-AMP) and pyrophosphate as products [Pubmed|23072323]
  • biosynthesis of the hypermodified base threonylcarbamoyladenosine (t(6)A), a universal modification found at position 37 of ANN decoding tRNAs, which imparts a unique structure to the anticodon loop enhancing its binding to ribosomes in vitro (shown for the corresponding ''E. coli'' protein YrdC) [Pubmed|19287007]
  • ATP + hydrogencarbonate + L-threonine --> diphosphate + H2O + L-threonylcarbamoyladenylate (according to UniProt)
  • Protein family

  • SUA5 family (single member, according to UniProt)
  • [SW|Domains]

  • YrdC-like domains (aa 18-205) (according to UniProt)
  • Structure

  • [PDB|1HRU] (the homolog from ''E. coli'') [Pubmed|19287007]
  • Expression and Regulation



    regulatory mechanism

  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [Pubmed|17932079], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • view in new tab

    Biological materials


  • MGNA-A195 (ywlC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36950 (Δ[gene|EA155B3BEB9EAC97114058E23B6D8CDF8823A602|tsaC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGACCAAACTCCTT, downstream forward: _UP4_TGAAAGCAGTCAGATGTTCT
  • BKK36950 (Δ[gene|EA155B3BEB9EAC97114058E23B6D8CDF8823A602|tsaC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGACCAAACTCCTT, downstream forward: _UP4_TGAAAGCAGTCAGATGTTCT
  • References

  • 17005971,17932079,19287007,23072323,22383849,26020636,26060251,26539825,28189581