SubtiBank SubtiBank
speB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

speB

agmatinase
locus
BSU37490
pI
4.77
mw
32.26 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast
function
spermidine, polyamine biosynthesis
product
agmatinase
essential
no
ec
3.5.3.11
synonyms
ywhG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.6|Metabolism of polyamines]
  • Gene

    Coordinates
    3,847,853 → 3,848,725

    The protein

    Catalyzed reaction/ biological activity

  • Agmatine + H2O = putrescine + urea (according to Swiss-Prot)
  • Protein family

  • Agmatinase subfamily (according to Swiss-Prot)
  • Structure

  • [PDB|3LHL] (from Clostridium difficile, 41% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|4F3E96C741561746B4E0EEA5AE29DB124C2F7249|speE]-[gene|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB]
    description
    [Pubmed|9723923]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9723923], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A522 (ywhG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/522 NBRP B. subtilis, Japan]
  • BKE37490 (Δ[gene|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATAATACCCTCGCTT, downstream forward: _UP4_TAAGTAAACATCCAGACGAT
  • BKK37490 (Δ[gene|EA0AA0ECBC4A36A3F01F5876900FE51243D9AD07|speB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATAATACCCTCGCTT, downstream forward: _UP4_TAAGTAAACATCCAGACGAT
  • References

  • 9723923