SubtiBank SubtiBank
yobK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yobK

antitoxin
locus
BSU_18990
pI
3.97
mw
17.57 kDa
protein length
152 aa Sequence Blast
gene length
459 bp Sequence Blast
function
inhibition of the cytotoxic activity of [protein|D24F5B473B9CFAD960D877A8BA593939012177E2|YobL]
product
antitoxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    Coordinates
    2,071,286 → 2,071,744

    The protein

    Structure

  • [PDB|2PRV]
  • Biological materials

    Mutant

  • MGNA-A308 (yobK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/308 NBRP B. subtilis, Japan]
  • BKE18990 (Δ[gene|E9FE0BA3CB7ABF98762F65B619ADC6BE0EC54B4E|yobK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCGAATAAATCATATAAA, downstream forward: _UP4_TAAGCAAAAGTATTGCTATA
  • BKK18990 (Δ[gene|E9FE0BA3CB7ABF98762F65B619ADC6BE0EC54B4E|yobK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCGAATAAATCATATAAA, downstream forward: _UP4_TAAGCAAAAGTATTGCTATA
  • References

  • 22200572