SubtiBank SubtiBank
yobK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yobK

antitoxin
locus
BSU_18990
pI
3.97
mw
17.57 kDa
protein length
152 aa Sequence Blast
gene length
459 bp Sequence Blast
function
inhibition of the cytotoxic activity of [protein|D24F5B473B9CFAD960D877A8BA593939012177E2|YobL]
product
antitoxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    Coordinates
    2,071,286 → 2,071,744

    The protein

    Structure

  • [PDB|2PRV]
  • Biological materials

    Mutant

  • MGNA-A308 (yobK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/308 NBRP B. subtilis, Japan]
  • BKE18990 (Δ[gene|E9FE0BA3CB7ABF98762F65B619ADC6BE0EC54B4E|yobK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCGAATAAATCATATAAA, downstream forward: _UP4_TAAGCAAAAGTATTGCTATA
  • BKK18990 (Δ[gene|E9FE0BA3CB7ABF98762F65B619ADC6BE0EC54B4E|yobK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCGAATAAATCATATAAA, downstream forward: _UP4_TAAGCAAAAGTATTGCTATA
  • References

  • 22200572