SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional repressor of the dra-nupC-pdp operon
35.10 kDa
protein length
313 aa Sequence Blast
gene length
942 bp Sequence Blast
regulation of deoxyribonucleotide utilization
transcriptional repressor

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    4,052,379 → 4,053,320

    The protein

    Catalyzed reaction/ biological activity

  • transcription repression of the ''[gene|81CD1F97E887549F7FB742FCEF38B86B84383F5D|dra]-[gene|4F718681A7AD0C86B2551248570F493AC0B2E7E9|nupC]-[gene|D2EB7BBAC8817912DAC4E215879F5A4E2C47ECAF|pdp]'' operon
  • Protein family

  • sorC transcriptional regulatory family (according to Swiss-Prot) DeoR family of transcription repressors
  • [SW|Domains]

  • N-terminal DNA-binding domain [Pubmed|24863636]
  • C-terminal effector binding domain [Pubmed|24863636]
  • Effectors of protein activity

  • deoxyribose-5-phosphate acts as the molecular inducer [Pubmed|24863636]
  • Structure

  • [PDB|4OQQ] (C-terminal effector binding domain) [Pubmed|24863636]
  • [ 4OQP] (C-terminal effector binding domain bound to the effector deoxyribose-5-phosphate ) [Pubmed|24863636]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE39430 (Δ[gene|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|deoR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGCACCTCCCTGTGG, downstream forward: _UP4_TGACACGTTCAAACCTTTCA
  • BKK39430 (Δ[gene|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|deoR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGCACCTCCCTGTGG, downstream forward: _UP4_TGACACGTTCAAACCTTTCA
  • References

  • 10714997,8550462,10074062,24863636