SubtiBank SubtiBank
glpQ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

glpQ

glycerolphosphate diester phosphodiesterase, degrades wall teichoic acid during phosphate starvation
locus
BSU_02130
pI
9.26
mw
32.81 kDa
protein length
293 aa Sequence Blast
gene length
882 bp Sequence Blast
function
glycerol-3-phosphate utilization, degradation of wall teichoic acid during phosphate starvation
product
glycerolphosphate diester phosphodiesterase
essential
no
ec
3.1.4.46
synonyms
ybeD

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.3|Utilization of cell wall components]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.3|Utilization of glycerol/ glycerol-3-phosphate]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.1|Utilization of phospholipids]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    233,014 → 233,895

    The protein

    Catalyzed reaction/ biological activity

  • exohydrolytic activity on wall teichoic acid, acts in concert with [protein|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|PhoD] [Pubmed|27780866]
  • removes glycerolphosphates from the free end of the unsubstituted wall teichoic acid up to the peptidoglycan linker [pubmed|32047114]
  • sn-glycero-3-phosphoester + H2O --> alcohol + H+ + sn-glycerol 3-phosphate (according to UniProt)
  • Protein family

  • glycerophosphoryl diester phosphodiesterase family (with [protein|04CACAF4F786090AB67D7C606C944F07B7A7FE55|YhdW], according to UniProt)
  • Paralogous protein(s)

  • [protein|04CACAF4F786090AB67D7C606C944F07B7A7FE55|YhdW], [protein|AF37A0E08AAAA9159DD1F0183A61713EF582E830|YqiK]
  • [SW|Domains]

  • GP-PDE domain (aa 38-290) (according to UniProt)
  • Structure

  • [PDB|5T9B] [Pubmed|27780866]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|ECCBD8EF461C24D693450E10EC268DBC7A440618|glpT]-[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]
    description
    [Pubmed|8012593]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8012593], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]: antitermination, via a protein-dependent [SW|RNA switch] [Pubmed|8012593], in [regulon|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|10913081], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by glycerol ([protein|search|GlpP]) [Pubmed|8012593]
  • view in new tab

    genes
    [gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]

    regulation

  • induced by glycerol ([protein|search|GlpP]) [Pubmed|8012593]
  • view in new tab

    Biological materials

    Mutant

  • BKE02130 (Δ[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTCTCCTCCTTATA, downstream forward: _UP4_TAAAAGCAAAAAACCTTGCG
  • BKK02130 (Δ[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTCTCCTCCTTATA, downstream forward: _UP4_TAAAAGCAAAAAACCTTGCG
  • References

    Reviews

  • 24373430
  • Original publications

  • 8012593,10913081,18214974,18957862,27780866,32047114