SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


glycerolphosphate diester phosphodiesterase, degrades wall teichoic acid during phosphate starvation
32.81 kDa
protein length
293 aa Sequence Blast
gene length
882 bp Sequence Blast
glycerol-3-phosphate utilization, degradation of wall teichoic acid during phosphate starvation
glycerolphosphate diester phosphodiesterase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of glycerol/ glycerol-3-phosphate]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW|Utilization of phospholipids]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    233,014 → 233,895

    The protein

    Catalyzed reaction/ biological activity

  • exohydrolytic activity on wall teichoic acid, acts in concert with [protein|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|PhoD] [Pubmed|27780866]
  • sn-glycero-3-phosphoester + H2O --> alcohol + H+ + sn-glycerol 3-phosphate (according to UniProt)
  • Protein family

  • glycerophosphoryl diester phosphodiesterase family (with [protein|04CACAF4F786090AB67D7C606C944F07B7A7FE55|YhdW], according to UniProt)
  • Paralogous protein(s)

  • [protein|04CACAF4F786090AB67D7C606C944F07B7A7FE55|YhdW], [protein|AF37A0E08AAAA9159DD1F0183A61713EF582E830|YqiK]
  • [SW|Domains]

  • GP-PDE domain (aa 38-290) (according to UniProt)
  • Structure

  • [PDB|5T9B] [Pubmed|27780866]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8012593], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]: antitermination, via a protein-dependent [SW|RNA switch] [Pubmed|8012593], in [regulon|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|10913081], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by glycerol ([protein|search|GlpP]) [Pubmed|8012593]
  • view in new tab



  • induced by glycerol ([protein|search|GlpP]) [Pubmed|8012593]
  • view in new tab

    Biological materials


  • BKE02130 (Δ[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTCTCCTCCTTATA, downstream forward: _UP4_TAAAAGCAAAAAACCTTGCG
  • BKK02130 (Δ[gene|E9BEF368F8E55888AD4849E8906E517831A882DF|glpQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTCTCCTCCTTATA, downstream forward: _UP4_TAAAAGCAAAAAACCTTGCG
  • References


  • 24373430
  • Original publications

  • 8012593,10913081,18214974,18957862,27780866