SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


dihydrolipoamide dehydrogenase E3 subunit of both pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase complexes
49.57 kDa
protein length
470 aa Sequence Blast
gene length
1413 bp Sequence Blast
links glycolysis and TCA cycle, enzyme in TCA cycle
dihydrolipoamide dehydrogenase E3 subunit of both pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase complexes

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    1,531,870 → 1,533,282

    Phenotypes of a mutant

  • defects in sporulation and unable to grow on glucose as single carbon source [Pubmed|11976308]
  • The protein

    Catalyzed reaction/ biological activity

  • Protein N6-(dihydrolipoyl)lysine + NAD+ --> protein N6-(lipoyl)lysine + NADH2 (according to UniProt)
  • Protein family

  • class-I pyridine nucleotide-disulfide oxidoreductase family (with [protein|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|AcoL] and [protein|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|LpdV], according to UniProt)
  • Paralogous protein(s)

  • [protein|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|LpdV], [protein|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|AcoL]
  • Kinetic information

  • Michaelis-Menten [Pubmed|6414463]
  • Modification

  • phosphorylated (Ser/Thr/Tyr) [Pubmed|17726680]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Effectors of protein activity

  • Inhibited thiamine 2-thiothiazolone diphosphate and NADH [Pubmed|6414463]
  • Low sensibility to NADPH [Pubmed|6414463]
  • Structure

  • [PDB|1EBD] (complex with binding domain of dihydrolipoamide acetylase, Geobacillus stearothermophilus), [PDB|1EBD] (complex with binding domain of dihydrolipoamide acetylase, ''Geobacillus stearothermophilus'')
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20081037], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, due to presence of guanine at 1 position of the transcript [Pubmed|20081037], in [regulon|stringent response|stringent response]
  • regulation

  • ''[protein|search|pdhA]'': expression activated by glucose (1.9-fold) [Pubmed|12850135]
  • view in new tab



  • ''[protein|search|pdhA]'': expression activated by glucose (1.9-fold) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • BKE14610 (Δ[gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGGAAATCTCCTACTACCA, downstream forward: _UP4_TAATTTTCATATCAAAAACA
  • BKK14610 (Δ[gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGGGAAATCTCCTACTACCA, downstream forward: _UP4_TAATTTTCATATCAAAAACA
  • lacZ fusion

  • pGP723 (in [SW|pAC5]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1427 (spc, based on [SW|pGP1331]), available in the [SW|Jörg Stülke]'s lab
  • References


  • 19476487,9655937,2227213,6805383,10672230,24798336
  • Original publications

  • 12850135,6414463,11976308,17726680,20081037,20933603,24204596,15378759