SubtiBank SubtiBank
yppG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yppG

spore coat protein
locus
BSU_22250
pI
9.51
mw
14.40 kDa
protein length
125 aa Sequence Blast
gene length
378 bp Sequence Blast
function
protection of the spore
product
spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • Gene

    Coordinates
    2,338,017 → 2,338,394

    The protein

    [SW|Localization]

  • spore coat (basement), localization depends on [protein|A25C1530DA7BB007A288E525404E9F775E219FE8|SpoIVA] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|E9ADA4957F3DCF471851B742309258569007BC6C|yppG]
    description
    [Pubmed|15383836]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|26577401,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|26577401], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|26577401,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A479 (yppG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/479 NBRP B. subtilis, Japan]
  • BKE22250 (Δ[gene|E9ADA4957F3DCF471851B742309258569007BC6C|yppG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCGATTCCCCCCTAAA, downstream forward: _UP4_TGATAGAAGCATGAATGAAT
  • BKK22250 (Δ[gene|E9ADA4957F3DCF471851B742309258569007BC6C|yppG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCGATTCCCCCCTAAA, downstream forward: _UP4_TGATAGAAGCATGAATGAAT
  • References

    Reviews

  • 27227299
  • Original publications

  • 22171814,15383836,26577401