SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


O-acetyl transferase, provides resistance to lysozyme
72.04 kDa
protein length
634 aa Sequence Blast
gene length
1905 bp Sequence Blast
resistance to lysozyme
O-acetyl transferase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,771,318 → 2,773,222

    Phenotypes of a mutant

  • increased sensitivity to lysozyme [Pubmed|21856855]
  • The protein

    Protein family

  • Acyltransferase 3 family (with [protein|A408883503931320B1BC04F38E6D475530518A25|YfiQ] and [protein|07A53089107037359C428549FF877638B90CF074|YkrP], according to UniProt)
  • Structure

  • [PDB|6VJP] (from Staphylococcus aureus, C-terminal extracytoplasmic domain) [pubmed|32350117]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, [Pubmed|21856855], in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulation

  • induced by lysozyme ([protein|search|SigV]) [Pubmed|21856855]
  • additional information

  • A [protein|search|ncRNA] ([SW|RnaC]) is encoded between '[protein|search|yrhK]' and '[protein|search|yrhJ]' [PubMed|25790031]
  • view in new tab

    Biological materials


  • MGNA-A146 (yrhL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27140 (Δ[gene|E97C7A219DB059BB634E893CC355A28324C87ADB|oatA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATTCCTCCAATAG, downstream forward: _UP4_TAAAAAAGAGATCCTATACA
  • BKK27140 (Δ[gene|E97C7A219DB059BB634E893CC355A28324C87ADB|oatA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTATTCCTCCAATAG, downstream forward: _UP4_TAAAAAAGAGATCCTATACA
  • References

    Research papers

  • 32350117,21856855,25790031