SubtiBank SubtiBank
atpH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

atpH

ATP synthase, part of the F1 complex (subunit delta)
locus
BSU_36840
pI
9.57
mw
19.84 kDa
protein length
181 aa Sequence Blast
gene length
546 bp Sequence Blast
function
ATP synthesis
product
ATP synthase (subunit delta)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.5|ATP synthesis] → [category|SW 2.1.5.1|ATPase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,785,403 → 3,785,948

    The protein

    Catalyzed reaction/ biological activity

  • ATP synthesis [http://www.youtube.com/watch?v=uOoHKCMAUMc see a video]
  • Protein family

  • ATPase delta chain family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-159 [Pubmed|22517742]
  • Effectors of protein activity

  • ATPase activity is inhibited upon binding of Mg-ADP to [protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD] [pubmed|30580998]
  • Structure

  • [PDB|5T4O] (ATPase from E. coli, 25% identity) [pubmed|28001127]
  • [SW|Localization]

  • membrane (Heterogeneous) [Pubmed|16479537]
  • peripheral via the F0 complex
  • http://subtiwiki.uni-goettingen.de/v3/gene/view/E956A30D97B2941108880F3AD48620C4DB6E0EBD
  • Expression and Regulation

    Operons

    genes
    [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI]-[gene|CC1894D90AC17487A286B2909964916825055F93|atpB]-[gene|6CF7F6303425D8A51E1E01BF18823139E4259A8F|atpE]-[gene|87311FEA265AD3F5526C78D631E7E51BBF01F0D6|atpF]-[gene|E956A30D97B2941108880F3AD48620C4DB6E0EBD|atpH]-[gene|E3FADE979CE6AB6315F67812608FCE00CF4E2453|atpA]-[gene|492EEC8068043DA770F5DC1D54799C4366AE9A01|atpG]-[gene|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|atpD]-[gene|A9DA64F8C7A60E8E2B1EDC99BEA1BD7DD0135AA6|atpC]
    description
    [Pubmed|9353933]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • the mRNA is processed between [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI] and [gene|CC1894D90AC17487A286B2909964916825055F93|atpB] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE36840 (Δ[gene|E956A30D97B2941108880F3AD48620C4DB6E0EBD|atpH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCGTTTAGAGACAGCTGATC, downstream forward: _UP4_AATCGATAGAAGGGGTGAAA
  • BKK36840 (Δ[gene|E956A30D97B2941108880F3AD48620C4DB6E0EBD|atpH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCGTTTAGAGACAGCTGATC, downstream forward: _UP4_AATCGATAGAAGGGGTGAAA
  • References

    Reviews

  • 23356252,23341301,23267178,22822068,21524994,19489730,17208001,16730323
  • Original publications

  • 7961438,22517742,16479537,28001127,30580998