SubtiBank SubtiBank
fni
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

fni

isopentenyl diphosphate isomerase, last (8th) step in the MEP pathway of isoprenoid biosynthesis
locus
BSU_22870
pI
6.10
mw
22.45 kDa
protein length
349 aa Sequence Blast
gene length
1050 bp Sequence Blast
function
MEP pathway of isoprenoid biosynthesis
product
isopentenyl diphosphate isomerase
essential
no
ec
5.3.3.2
synonyms
ypgA,idi

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.3|Biosynthesis of isoprenoids]
  • Gene

    Coordinates
    2,393,602 → 2,394,651

    The protein

    Catalyzed reaction/ biological activity

  • isopentenyl diphosphate --> dimethylallyl diphosphate (according to UniProt)
  • Protein family

  • IPP isomerase type 2 family (single member, according to UniProt)
  • Structure

  • [PDB|1P0N] (complex with FMN)
  • [PDB|1P0K]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]-[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]-[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]-[gene|3459BA0CDAABC288ADF97B111F78C7EAC184840D|ypfB]-[gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]-[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A420 (ypgA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/420 NBRP B. subtilis, Japan]
  • BKE22870 (Δ[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTCGAGTCACGTTTATCA, downstream forward: _UP4_TAAATGATAAAAGCCCAAAA
  • BKK22870 (Δ[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTCGAGTCACGTTTATCA, downstream forward: _UP4_TAAATGATAAAAGCCCAAAA
  • References

  • 12798687,17458547,14745175,23840410