lytF

gamma-D-glutamate-meso-diaminopimelate muropeptidase, cell separase (major autolysin)

Locus: BSU_09370

Isoelectric point: 10.41

Molecular weight: 51.23 kDa

Protein length: 488 aa

Gene length: 1467 bp

Function: cell separation

Product: gamma-D-glutamate-meso-diaminopimelate muropeptidase (major autolysin)

Essential: no

E.C.: 3.4.-.-

Synonyms: cwlE,yhdD

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall degradation/ turnover → Autolysis
• Cellular processes → Cell envelope and cell division → Cell wall degradation/ turnover → Endopeptidases

Gene

Coordinates: 1,011,792 → 1,013,258

Phenotypes of a mutant

• cell separation defect, this is increased by a lytE mutation PubMed

The protein

Catalyzed reaction/ biological activity

• cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) PubMed
• degradation of gamma-polyglutamic acid PubMed

Protein family

• Peptidase C40 family (according to UniProt)

Domains

• contains five N-acetylglucosamine-polymer-binding LysM domains PubMed
• C-terminal D,L-endopeptidase domain (NlpC/P60 domain) PubMed
• 5 LysM domains (aa 27-70, aa 92-135, aa 174-217, aa 240-283, aa 307-350) (according to UniProt)

Effectors of protein activity

• both enzymatic activities are inhibited by interaction with IseA PubMed

Structure

• 4XCM (from Thermus thermophilus, 31% identity) PubMed

Localization

• secreted (according to Swiss-Prot)
• localizes to cell septa and poles on the vegetative cell surface, this depends on the presence of lipoteichoic acids (LtaS) PubMed

Expression and Regulation

Operons

• Genes: lytF
  Description: PubMed

  Sigma factors

  • SigD: sigma factor, PubMed, in SigD regulon

  Regulatory mechanism

  • SlrR: repression, in SlrR regulon
  • SinR: repression, in SinR regulon

Biological materials

Mutant

• 1A791 ( lytF::spec), PubMed, available at BGSC
• 1A792 ( lytF::spec), PubMed, available at BGSC
• BKE09370 (ΔlytF::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTTAGCTCTCCTTTTTC, downstream forward: _UP4_TAAAAACAGAAACTGTGCGG
• BKK09370 (ΔlytF::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTTAGCTCTCCTTTTTC, downstream forward: _UP4_TAAAAACAGAAACTGTGCGG

References

Reviews

Loading

Original publications

Loading