SubtiBank SubtiBank
lytF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lytF

gamma-D-glutamate-meso-diaminopimelate muropeptidase, cell separase (major autolysin)
locus
BSU_09370
pI
10.41
mw
51.23 kDa
protein length
488 aa Sequence Blast
gene length
1467 bp Sequence Blast
function
cell separation
product
gamma-D-glutamate-meso-diaminopimelate muropeptidase (major autolysin)
essential
no
ec
3.4.-.-
synonyms
cwlE,yhdD

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.4|Endopeptidases]
  • Gene

    Coordinates
    1,011,792 → 1,013,258

    Phenotypes of a mutant

  • cell separation defect, this is increased by a ''[gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutation [Pubmed|23855774]
  • The protein

    Catalyzed reaction/ biological activity

  • cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]
  • degradation of gamma-polyglutamic acid [pubmed|29458655]
  • Protein family

  • [SW|Peptidase C40 family] (according to UniProt)
  • [SW|Domains]

  • contains five N-acetylglucosamine-polymer-binding [SW|LysM domain]s [Pubmed|18430080]
  • C-terminal D,L-endopeptidase domain ([SW|NlpC/P60 domain]) [pubmed|29458655,22139507]
  • 5 [SW|LysM domain]s (aa 27-70, aa 92-135, aa 174-217, aa 240-283, aa 307-350) (according to UniProt)
  • Effectors of protein activity

  • both enzymatic activities are inhibited by interaction with [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|IseA] [pubmed|29458655]
  • Structure

  • [PDB|4XCM] (from Thermus thermophilus, 31% identity) [pubmed|25760608]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • localizes to cell septa and poles on the vegetative cell surface, this depends on the presence of lipoteichoic acids ([protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS]) [Pubmed|25288647,22139507]
  • Expression and Regulation

    Operons

    genes
    [gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]
    description
    [Pubmed|10322020]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|10322020], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|920F91E748EE079FF864011D9052B073567C41E4|SlrR]: repression, in [regulon|920F91E748EE079FF864011D9052B073567C41E4|SlrR regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • view in new tab

    Biological materials

    Mutant

  • 1A791 ( ''lytF''::''spec''), [Pubmed|10206711], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A791&Search=1A791 BGSC]
  • 1A792 ( ''lytF''::''spec''), [Pubmed|1588906], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A792&Search=1A792 BGSC]
  • BKE09370 (Δ[gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAGCTCTCCTTTTTC, downstream forward: _UP4_TAAAAACAGAAACTGTGCGG
  • BKK09370 (Δ[gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAGCTCTCCTTTTTC, downstream forward: _UP4_TAAAAACAGAAACTGTGCGG
  • References

    Reviews

  • 18430080,18266855
  • Original publications

  • 20351052,10322020,10206711,14594841,18761696,19542270,22139507,23855774,23091053,25288647,29458655,29458657,25760608