SubtiBank SubtiBank
licA
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

licA

lichenan-specific phosphotransferase system, EIIA component of the PTS
locus
BSU38570
pI
4.64
mw
12.04 kDa
protein length
110 aa Sequence Blast
gene length
330 bp Sequence Blast
function
lichenan uptake and phosphorylation
product
lichenan-specific phosphotransferase system, EIIA component
essential
no
synonyms
celC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    3,959,841 → 3,960,173

    The protein

    Catalyzed reaction/ biological activity

  • Protein EIIA N(pi)-phospho-L-histidine + protein EIIB = protein EIIA + protein EIIB N(pi)-phospho-L-histidine/cysteine (according to Swiss-Prot)
  • Protein family

  • [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] permease, lactose permease (Lac) family [Pubmed|10627040]
  • Structure

  • [PDB|3K1S] (IIA(Cel) from ''B. anthracis'', 42% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]-[gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]-[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]-[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]
    description
    [Pubmed|8990303]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8990303], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8990303], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|LicR]: activation, [Pubmed|8990303], in [regulon|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|LicR regulon]
  • regulation

  • carbon catabolite repression ([protein|search|CcpA]) [Pubmed|8990303]
  • view in new tab

    Biological materials

    Mutant

  • BKE38570 (Δ[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCACGCGATTCACTTCCT, downstream forward: _UP4_ACCGAGCAAAGGGGAGCAAG
  • BKK38570 (Δ[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCACGCGATTCACTTCCT, downstream forward: _UP4_ACCGAGCAAAGGGGAGCAAG
  • References

  • 19087206,8990303,16872404,10438772,10627040,8990303,27766092