SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


8.00 kDa
protein length
gene length
216 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    861,586 → 861,801

    The protein

    Protein family

  • UPF0435 family (according to Swiss-Prot)
  • Modification

  • phosphorylation on Ser-57 [Pubmed|17218307]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-C346 (yfkK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07870 (Δ[gene|E8B1846CEF630C3CD89B3A92E9D8BE9DBC84FD68|yfkK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTTCCATCCTTTCT, downstream forward: _UP4_TAATGGAGACTGGCCGGAAA
  • BKK07870 (Δ[gene|E8B1846CEF630C3CD89B3A92E9D8BE9DBC84FD68|yfkK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTTCCATCCTTTCT, downstream forward: _UP4_TAATGGAGACTGGCCGGAAA
  • References

  • 17218307