SubtiBank SubtiBank
yfkK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfkK

unknown
locus
BSU_07870
pI
4.64
mw
8.00 kDa
protein length
gene length
216 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    861,586 → 861,801

    The protein

    Protein family

  • UPF0435 family (single member, according to UniProt)
  • Modification

  • phosphorylation on Ser-57 [Pubmed|17218307]
  • Expression and Regulation

    Operons

    genes
    [gene|E8B1846CEF630C3CD89B3A92E9D8BE9DBC84FD68|yfkK]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|E8B1846CEF630C3CD89B3A92E9D8BE9DBC84FD68|yfkK]-[gene|E6C213ABCE165A54897A7DB5EE24481B94A4CDD0|yfkL]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C346 (yfkK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2344 NBRP B. subtilis, Japan]
  • BKE07870 (Δ[gene|E8B1846CEF630C3CD89B3A92E9D8BE9DBC84FD68|yfkK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTTCCATCCTTTCT, downstream forward: _UP4_TAATGGAGACTGGCCGGAAA
  • BKK07870 (Δ[gene|E8B1846CEF630C3CD89B3A92E9D8BE9DBC84FD68|yfkK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTTCCATCCTTTCT, downstream forward: _UP4_TAATGGAGACTGGCCGGAAA
  • References

  • 17218307