SubtiBank SubtiBank
ylaN

ylaN

unknown
locus
BSU_14840
pI
4.61
mw
10.60 kDa
protein length
gene length
282 bp Sequence Blast
function
unknown
product
unknown
essential
yes
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,552,412 → 1,552,693

    Phenotypes of a mutant

  • essential [Pubmed|12682299], the mutant is viable if iron(III) is added to the medium [Pubmed|27238023]
  • The protein

    Protein family

  • UPF0358 family (single member, according to UniProt)
  • Structure

  • [PDB|2ODM] [Pubmed|17469204]
  • Expression and Regulation

    Operons

    genes
    [gene|E87DFC182D54EE96D4CA57607E734CDFB18E74EF|ylaN]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE14840 (Δ[gene|E87DFC182D54EE96D4CA57607E734CDFB18E74EF|ylaN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGTATCCCTCCGTTCC, downstream forward: _UP4_TAAATGATAAAACTCAAACT
  • BKK14840 (Δ[gene|E87DFC182D54EE96D4CA57607E734CDFB18E74EF|ylaN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGTATCCCTCCGTTCC, downstream forward: _UP4_TAAATGATAAAACTCAAACT
  • Expression vectors

  • IPTG inducible expression of Strep-''ylaN'' in ''E. coli'': pGP2579 (in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • IPTG inducible expression of His-''ylaN'' in ''E. coli'': pGP2583 (in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Jörg Stülke]'s lab
  • References

  • 17005971,17469204,22383849,23420519,27238023,28189581