SubtiBank SubtiBank
ylaN
The papers of the month are back! Check them out! Link here

ylaN

unknown
locus
BSU14840
pI
4.61
mw
10.60 kDa
protein length
gene length
279 bp Sequence Blast
function
unknown
product
unknown
essential
yes
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,552,412 → 1,552,693

    Phenotypes of a mutant

  • essential [Pubmed|12682299], the mutant is viable if iron(III) is added to the medium [Pubmed|27238023]
  • The protein

    Protein family

  • UPF0358 family (according to Swiss-Prot)
  • Structure

  • [PDB|2ODM] [Pubmed|17469204]
  • Expression and Regulation

    Operons

    genes
    [gene|E87DFC182D54EE96D4CA57607E734CDFB18E74EF|ylaN]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE14840 (Δ[gene|E87DFC182D54EE96D4CA57607E734CDFB18E74EF|ylaN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGTATCCCTCCGTTCC, downstream forward: _UP4_TAAATGATAAAACTCAAACT
  • BKK14840 (Δ[gene|E87DFC182D54EE96D4CA57607E734CDFB18E74EF|ylaN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGTATCCCTCCGTTCC, downstream forward: _UP4_TAAATGATAAAACTCAAACT
  • Expression vector

  • IPTG inducible expression of Strep-''ylaN'' in ''E. coli'': pGP2579 (in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • IPTG inducible expression of His-''ylaN'' in ''E. coli'': pGP2583 (in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Jörg Stülke]'s lab
  • References

  • 17005971,17469204,22383849,23420519,27238023,28189581