SubtiBank SubtiBank
yqbK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqbK

similar to sheath tail protein
locus
BSU_26075
pI
4.70
mw
51.00 kDa
protein length
466 aa Sequence Blast
gene length
1401 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,679,588 → 2,680,988

    The protein

    Protein family

  • myoviridae tail sheath protein family (with [protein|31B1832E5EAD957EE6A5C7CB0C117EC0F26AA8AB|XkdK], according to UniProt)
  • Structure

  • [PDB|3LML] (from Listeria innocua, 52% identity)
  • Biological materials

    Mutant

  • BKE26075 (Δ[gene|E8728725267F316B0DECC2AF316C3A35BC7A2F99|yqbK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26075 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTGACCTCCTTTT, downstream forward: _UP4_TTTAATGTTGAGGTGAAATA
  • BKK26075 (Δ[gene|E8728725267F316B0DECC2AF316C3A35BC7A2F99|yqbK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26075 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTGACCTCCTTTT, downstream forward: _UP4_TTTAATGTTGAGGTGAAATA