SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to sheath tail protein
51.00 kDa
protein length
466 aa Sequence Blast
gene length
1401 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,679,588 → 2,680,988

    The protein

    Protein family

  • myoviridae tail sheath protein family (with [protein|31B1832E5EAD957EE6A5C7CB0C117EC0F26AA8AB|XkdK], according to UniProt)
  • Structure

  • [PDB|3LML] (from Listeria innocua, 52% identity)
  • Biological materials


  • BKE26075 (Δ[gene|E8728725267F316B0DECC2AF316C3A35BC7A2F99|yqbK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTGACCTCCTTTT, downstream forward: _UP4_TTTAATGTTGAGGTGAAATA
  • BKK26075 (Δ[gene|E8728725267F316B0DECC2AF316C3A35BC7A2F99|yqbK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTGACCTCCTTTT, downstream forward: _UP4_TTTAATGTTGAGGTGAAATA