SubtiBank SubtiBank
yqbK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbK

similar to sheath tail protein
locus
BSU26075
pI
4.70
mw
51.00 kDa
protein length
466 aa Sequence Blast
gene length
1401 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,679,588 → 2,680,988

    The protein

    Structure

  • [PDB|3LML] (from Listeria innocua, 52% identity)
  • Biological materials

    Mutant

  • BKE26075 (Δ[gene|E8728725267F316B0DECC2AF316C3A35BC7A2F99|yqbK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26075 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTGACCTCCTTTT, downstream forward: _UP4_TTTAATGTTGAGGTGAAATA
  • BKK26075 (Δ[gene|E8728725267F316B0DECC2AF316C3A35BC7A2F99|yqbK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26075 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATTTGACCTCCTTTT, downstream forward: _UP4_TTTAATGTTGAGGTGAAATA