SubtiBank SubtiBank
serC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

serC

3-phosphoserine aminotransferase
locus
BSU_10020
pI
5.52
mw
39.98 kDa
protein length
359 aa Sequence Blast
gene length
1080 bp Sequence Blast
function
biosynthesis of serine
product
3-phosphoserine aminotransferase
essential
no
ec
2.6.1.52
synonyms
yhaF,glyB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.8|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • Gene

    Coordinates
    1,075,289 → 1,076,368

    The protein

    Catalyzed reaction/ biological activity

  • 2-oxoglutarate + O-phospho-L-serine --> 3-phosphooxypyruvate + L-glutamate (according to UniProt)
  • 2-oxoglutarate + 4-(phosphooxy)-L-threonine --> (R)-3-hydroxy-2-oxo-4-phosphooxybutanoate + L-glutamate (according to UniProt)
  • Protein family

  • [SW|Class-V pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|1W23] (from ''Bacillus alcalophilus'', 59% identity) [Pubmed|15608117]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|E7ED2FB756B47A0F2C73E42E4168D16F20BD7B1B|serC]-[gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A685 (serC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/685 NBRP B. subtilis, Japan]
  • 1A621 ( ''serC''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A621&Search=1A621 BGSC]
  • BKE10020 (Δ[gene|E7ED2FB756B47A0F2C73E42E4168D16F20BD7B1B|serC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGATCTCTCCCTGTT, downstream forward: _UP4_TAAAAAGTCTGGCTATGCAA
  • BKK10020 (Δ[gene|E7ED2FB756B47A0F2C73E42E4168D16F20BD7B1B|serC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGATCTCTCCCTGTT, downstream forward: _UP4_TAAAAAGTCTGGCTATGCAA
  • References

  • 9579061, 15378759,15608117