SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


22.80 kDa
protein length
204 aa Sequence Blast
gene length
615 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,697,651 → 1,698,265

    Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|20233303], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: regulation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • regulation

  • see [SW|fla-che operon]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • MGNA-B103 (ylxF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE16260 (Δ[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGCCGGACATTACATTCG, downstream forward: _UP4_AGCCAAGAATAGGGGGAATG
  • BKK16260 (Δ[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGCCGGACATTACATTCG, downstream forward: _UP4_AGCCAAGAATAGGGGGAATG
  • lacZ fusion

  • pGP1088 (in [SW|pAC6]), available in [SW|Stülke] lab
  • References

  • 14651647,9657996,8157612,15175317,20233303,17850253,24386445