SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


carbamoyl-phosphate synthetase (glutaminase subunit)
39.96 kDa
protein length
364 aa Sequence Blast
gene length
1095 bp Sequence Blast
pyrimidine biosynthesis
carbamoyl-phosphate synthetase (glutaminase subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    1,622,657 → 1,623,751

    The protein

    Catalyzed reaction/ biological activity

  • 2 ATP + H2O + hydrogencarbonate + L-glutamine --> 2 ADP + carbamoyl phosphate + 2 H+ + L-glutamate + phosphate (according to UniProt)
  • Protein family

  • CarA family (with [protein|4202EAE5D0B2A718382092423DD99E35FDE81218|CarA], according to UniProt)
  • Paralogous protein(s)

  • [protein|4202EAE5D0B2A718382092423DD99E35FDE81218|CarA]
  • [SW|Domains]

  • [SW|Glutamine amidotransferase type-1 domain] (aa 171-356) (according to UniProt)
  • Structure

  • [PDB|1JDB] (from ''E. coli'', 47% identity) [Pubmed|10089390]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials


  • BKE15510 (Δ[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTTCCAGTACTAATCGTC, downstream forward: _UP4_ACAGAGAAAGAAGGGGAAGC
  • BKK15510 (Δ[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTTCCAGTACTAATCGTC, downstream forward: _UP4_ACAGAGAAAGAAGGGGAAGC
  • References


  • 12859215,11395405,11163353
  • Original publications

  • 8206849,1709162,10089390,8663035,28516784