SubtiBank SubtiBank
sigX [2017-10-30 18:48:56]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sigX [2017-10-30 18:48:56]

RNA polymerase ECF-type sigma factor SigX, required for resistance against cationic antimicrobial peptides
23.03 kDa
protein length
194 aa Sequence Blast
gene length
582 bp Sequence Blast
resistance to cationic antimcrobial peptides
RNA polymerase ECF-type sigma factor SigX

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,414,627 → 2,415,211

    The protein

    Protein family

  • ECF subfamily (according to Swiss-Prot)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Additional information

  • Expression of the [SW|SigX regulon] in increased in ''[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]'' mutants [Pubmed|22362028]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9636707], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • regulation

  • induced by glucose [Pubmed|27965645], this depends on [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials


  • MGNA-A179 (sigX::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A901 ( ''sigX''::''spec''), [Pubmed| ], available at [ BGSC]
  • BKE23100 (Δ[gene|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAACCCCTCCGTTC, downstream forward: _UP4_GAGCTTTTGAGGGAGGAGCT
  • BKK23100 (Δ[gene|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAACCCCTCCGTTC, downstream forward: _UP4_GAGCTTTTGAGGGAGGAGCT
  • References


  • 24921931,26901131
  • The [SW|SigX regulon]

  • 9683469,17675383,10960106
  • Other original publications

  • 11222589,9139908,14993308,12399481,14762009,19047346,14651641,19465659,9636707,16306698,7934830,19767430,9393439,22362028,23103977,20817771,26364265,27137497,27965645