SubtiBank SubtiBank
sigX [2019-04-14 15:47:42]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sigX [2019-04-14 15:47:42]

[SW|RNA polymerase] ECF-type [SW|sigma factor] SigX, required for resistance against cationic antimicrobial peptides
locus
BSU23100
pI
6.09
mw
23.03 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
function
resistance to cationic antimcrobial peptides
product
[SW|RNA polymerase] ECF-type [SW|sigma factor] SigX
essential
no
synonyms
ypuM

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.2|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.1|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,414,627 → 2,415,211

    The protein

    Protein family

  • [SW|Sigma-70 factor family] (according to UniProt)
  • Structure

  • [PDB|6DXO] (from Streptomyces venezuelae, 28% identity) [pubmed|29905823]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Additional information

  • Expression of the [SW|SigX regulon] in increased in ''[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]'' mutants [Pubmed|22362028]
  • Expression and Regulation

    Operons

    genes
    [gene|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]-[gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX]
    description
    [Pubmed|7934830]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9636707], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • regulation

  • induced by glucose [Pubmed|27965645], this depends on [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A179 (sigX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/179 NBRP B. subtilis, Japan]
  • 1A901 ( ''sigX''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A901&Search=1A901 BGSC]
  • BKE23100 (Δ[gene|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAACCCCTCCGTTC, downstream forward: _UP4_GAGCTTTTGAGGGAGGAGCT
  • BKK23100 (Δ[gene|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAACCCCTCCGTTC, downstream forward: _UP4_GAGCTTTTGAGGGAGGAGCT
  • References

    Reviews

  • 24921931,26901131
  • The [SW|SigX regulon]

  • 9683469,17675383,10960106
  • Other original publications

  • 11222589,9139908,14993308,12399481,14762009,19047346,14651641,19465659,9636707,16306698,7934830,19767430,9393439,22362028,23103977,20817771,26364265,27137497,27965645,30355672,29905823